Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626033_at:

>probe:Drosophila_2:1626033_at:665:275; Interrogation_Position=2267; Antisense; CTTCCGCCAGATGTTGCAGCAGAAT
>probe:Drosophila_2:1626033_at:730:113; Interrogation_Position=2284; Antisense; AGCAGAATCTGTCCGCCAGTGTCGG
>probe:Drosophila_2:1626033_at:340:81; Interrogation_Position=2362; Antisense; AGGGTCCGACGGATACACTGCTCTA
>probe:Drosophila_2:1626033_at:284:619; Interrogation_Position=2380; Antisense; TGCTCTACGGACTCTGTGGTGTGGA
>probe:Drosophila_2:1626033_at:230:351; Interrogation_Position=2416; Antisense; GCAGCACTCCCTTGAATGTGGGCGT
>probe:Drosophila_2:1626033_at:464:507; Interrogation_Position=2458; Antisense; GTGCCCTCTATTTGCACGAGCTGAA
>probe:Drosophila_2:1626033_at:706:555; Interrogation_Position=2528; Antisense; GGACGAGCGTCCTGGTACGAGCCAT
>probe:Drosophila_2:1626033_at:360:513; Interrogation_Position=2613; Antisense; GTGATTACCTCAAAGGCTGCCGAGA
>probe:Drosophila_2:1626033_at:423:101; Interrogation_Position=2635; Antisense; AGAGCACGCCGCTTTTGGGTAGCAT
>probe:Drosophila_2:1626033_at:192:691; Interrogation_Position=2648; Antisense; TTTGGGTAGCATCCGCTCATAGCAG
>probe:Drosophila_2:1626033_at:211:27; Interrogation_Position=2666; Antisense; ATAGCAGCGGCCAGAGTGGATCTAA
>probe:Drosophila_2:1626033_at:510:517; Interrogation_Position=2681; Antisense; GTGGATCTAACCACCTGTAGAGCTA
>probe:Drosophila_2:1626033_at:304:555; Interrogation_Position=2707; Antisense; GGACCACCCATTCTGCTATTAGTGA
>probe:Drosophila_2:1626033_at:306:199; Interrogation_Position=2762; Antisense; AACGACGTCGTCTAGTGCGTAGCTA

Paste this into a BLAST search page for me
CTTCCGCCAGATGTTGCAGCAGAATAGCAGAATCTGTCCGCCAGTGTCGGAGGGTCCGACGGATACACTGCTCTATGCTCTACGGACTCTGTGGTGTGGAGCAGCACTCCCTTGAATGTGGGCGTGTGCCCTCTATTTGCACGAGCTGAAGGACGAGCGTCCTGGTACGAGCCATGTGATTACCTCAAAGGCTGCCGAGAAGAGCACGCCGCTTTTGGGTAGCATTTTGGGTAGCATCCGCTCATAGCAGATAGCAGCGGCCAGAGTGGATCTAAGTGGATCTAACCACCTGTAGAGCTAGGACCACCCATTCTGCTATTAGTGAAACGACGTCGTCTAGTGCGTAGCTA

Full Affymetrix probeset data:

Annotations for 1626033_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime