FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626036_at:

>probe:Drosophila_2:1626036_at:722:331; Interrogation_Position=15; Antisense; GCTGGCCCGGTTATCCTAATTGGAG
>probe:Drosophila_2:1626036_at:382:331; Interrogation_Position=176; Antisense; GCGGCACCGCGACCAATAGATTTGG
>probe:Drosophila_2:1626036_at:247:25; Interrogation_Position=191; Antisense; ATAGATTTGGCCAAGCCCAAGCGAA
>probe:Drosophila_2:1626036_at:383:253; Interrogation_Position=202; Antisense; CAAGCCCAAGCGAACTGAAGACAAC
>probe:Drosophila_2:1626036_at:532:197; Interrogation_Position=224; Antisense; AACGAGAGTTGCAGCCCGCCAAAGG
>probe:Drosophila_2:1626036_at:705:169; Interrogation_Position=244; Antisense; AAAGGCAACAAACCCAGGACCACAT
>probe:Drosophila_2:1626036_at:247:201; Interrogation_Position=254; Antisense; AACCCAGGACCACATGCAACAATCG
>probe:Drosophila_2:1626036_at:92:655; Interrogation_Position=31; Antisense; TAATTGGAGTTTTTCAGCCCTCGTC
>probe:Drosophila_2:1626036_at:319:329; Interrogation_Position=371; Antisense; GCGGAAGCGAGCTCCGGCGACTTAT
>probe:Drosophila_2:1626036_at:30:631; Interrogation_Position=383; Antisense; TCCGGCGACTTATGGCCATGTTTGT
>probe:Drosophila_2:1626036_at:715:575; Interrogation_Position=395; Antisense; TGGCCATGTTTGTTGTACGGGTTTT
>probe:Drosophila_2:1626036_at:341:699; Interrogation_Position=40; Antisense; TTTTTCAGCCCTCGTCATGATGCGG
>probe:Drosophila_2:1626036_at:30:141; Interrogation_Position=411; Antisense; ACGGGTTTTCCCCAGCTCAGCTGAA
>probe:Drosophila_2:1626036_at:291:191; Interrogation_Position=89; Antisense; AACTCTCGGCCGCAAAAGGACACGG

Paste this into a BLAST search page for me
GCTGGCCCGGTTATCCTAATTGGAGGCGGCACCGCGACCAATAGATTTGGATAGATTTGGCCAAGCCCAAGCGAACAAGCCCAAGCGAACTGAAGACAACAACGAGAGTTGCAGCCCGCCAAAGGAAAGGCAACAAACCCAGGACCACATAACCCAGGACCACATGCAACAATCGTAATTGGAGTTTTTCAGCCCTCGTCGCGGAAGCGAGCTCCGGCGACTTATTCCGGCGACTTATGGCCATGTTTGTTGGCCATGTTTGTTGTACGGGTTTTTTTTTCAGCCCTCGTCATGATGCGGACGGGTTTTCCCCAGCTCAGCTGAAAACTCTCGGCCGCAAAAGGACACGG

Full Affymetrix probeset data:

Annotations for 1626036_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720