Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626037_at:

>probe:Drosophila_2:1626037_at:694:113; Interrogation_Position=140; Antisense; AGCAGCTGGGCCATCAAGTGGTCTG
>probe:Drosophila_2:1626037_at:247:401; Interrogation_Position=15; Antisense; GTTACTCTCCCGCAAGGAAATCGTA
>probe:Drosophila_2:1626037_at:482:219; Interrogation_Position=155; Antisense; AAGTGGTCTGCGTGGGAACTGCCTA
>probe:Drosophila_2:1626037_at:663:193; Interrogation_Position=171; Antisense; AACTGCCTACATTTGCCTGATTTAC
>probe:Drosophila_2:1626037_at:380:459; Interrogation_Position=189; Antisense; GATTTACGCCATGAGCACCTGGTTA
>probe:Drosophila_2:1626037_at:421:73; Interrogation_Position=232; Antisense; AGGACCCGTCTGCACATGCGATTGG
>probe:Drosophila_2:1626037_at:241:29; Interrogation_Position=283; Antisense; ATACTGTTTAACTGCGCTTCTACCT
>probe:Drosophila_2:1626037_at:692:653; Interrogation_Position=317; Antisense; TAACCGGCGTTTCATTTTCAAAGCT
>probe:Drosophila_2:1626037_at:320:245; Interrogation_Position=360; Antisense; AATTTTCCTCTTTAGCAGCTTTGCA
>probe:Drosophila_2:1626037_at:585:483; Interrogation_Position=37; Antisense; GTATCGTTATTGCTATTCCTCACGG
>probe:Drosophila_2:1626037_at:21:69; Interrogation_Position=385; Antisense; ATGGCCTCCAAATCGGTCAGTTTGA
>probe:Drosophila_2:1626037_at:424:495; Interrogation_Position=400; Antisense; GTCAGTTTGAGCATGTCGGCCATCA
>probe:Drosophila_2:1626037_at:36:369; Interrogation_Position=503; Antisense; GAATGCGTTACCTCGAGTCGCAAAA
>probe:Drosophila_2:1626037_at:108:95; Interrogation_Position=77; Antisense; AGATCATTTCCGTGCTGAACGCGTC

Paste this into a BLAST search page for me
AGCAGCTGGGCCATCAAGTGGTCTGGTTACTCTCCCGCAAGGAAATCGTAAAGTGGTCTGCGTGGGAACTGCCTAAACTGCCTACATTTGCCTGATTTACGATTTACGCCATGAGCACCTGGTTAAGGACCCGTCTGCACATGCGATTGGATACTGTTTAACTGCGCTTCTACCTTAACCGGCGTTTCATTTTCAAAGCTAATTTTCCTCTTTAGCAGCTTTGCAGTATCGTTATTGCTATTCCTCACGGATGGCCTCCAAATCGGTCAGTTTGAGTCAGTTTGAGCATGTCGGCCATCAGAATGCGTTACCTCGAGTCGCAAAAAGATCATTTCCGTGCTGAACGCGTC

Full Affymetrix probeset data:

Annotations for 1626037_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime