Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626038_at:

>probe:Drosophila_2:1626038_at:643:145; Interrogation_Position=1043; Antisense; ACTCAGTGTTTGTGGTGCAGTTCCT
>probe:Drosophila_2:1626038_at:533:283; Interrogation_Position=1066; Antisense; CTGCTCAGTTGCGTTATGGGTTTCA
>probe:Drosophila_2:1626038_at:204:65; Interrogation_Position=1081; Antisense; ATGGGTTTCATCCTATCGTACAGCA
>probe:Drosophila_2:1626038_at:329:59; Interrogation_Position=1189; Antisense; ATGTTCATTGGAGGCGACTACGTCT
>probe:Drosophila_2:1626038_at:310:645; Interrogation_Position=1211; Antisense; TCTTCTCGTGGCTCAACTGTATTGG
>probe:Drosophila_2:1626038_at:543:729; Interrogation_Position=1232; Antisense; TTGGGATCAACATCAGCGTGCTGGC
>probe:Drosophila_2:1626038_at:507:583; Interrogation_Position=1253; Antisense; TGGCTAGTCTGCTCTACACGTACGT
>probe:Drosophila_2:1626038_at:645:487; Interrogation_Position=1272; Antisense; GTACGTCACTTTTCGGCGGAAGCGG
>probe:Drosophila_2:1626038_at:595:331; Interrogation_Position=1331; Antisense; GCGGCGAGAATGTCTAGCTTCATCT
>probe:Drosophila_2:1626038_at:691:595; Interrogation_Position=1406; Antisense; TGTGTACTTCAATTGCGATCTGCGA
>probe:Drosophila_2:1626038_at:638:609; Interrogation_Position=1426; Antisense; TGCGATTCGCGACAACGTTCGTATT
>probe:Drosophila_2:1626038_at:78:693; Interrogation_Position=1449; Antisense; TTTGATTTTCCTACAACCACACAGC
>probe:Drosophila_2:1626038_at:682:123; Interrogation_Position=1471; Antisense; AGCGCATCGTCTCTGTACATATATC
>probe:Drosophila_2:1626038_at:554:347; Interrogation_Position=1562; Antisense; GCATGCAACTGTTTCCTGCATCGAA

Paste this into a BLAST search page for me
ACTCAGTGTTTGTGGTGCAGTTCCTCTGCTCAGTTGCGTTATGGGTTTCAATGGGTTTCATCCTATCGTACAGCAATGTTCATTGGAGGCGACTACGTCTTCTTCTCGTGGCTCAACTGTATTGGTTGGGATCAACATCAGCGTGCTGGCTGGCTAGTCTGCTCTACACGTACGTGTACGTCACTTTTCGGCGGAAGCGGGCGGCGAGAATGTCTAGCTTCATCTTGTGTACTTCAATTGCGATCTGCGATGCGATTCGCGACAACGTTCGTATTTTTGATTTTCCTACAACCACACAGCAGCGCATCGTCTCTGTACATATATCGCATGCAACTGTTTCCTGCATCGAA

Full Affymetrix probeset data:

Annotations for 1626038_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime