Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626039_at:

>probe:Drosophila_2:1626039_at:682:365; Interrogation_Position=1038; Antisense; GAATCAACAGCTGGTACGGCACATG
>probe:Drosophila_2:1626039_at:263:671; Interrogation_Position=1052; Antisense; TACGGCACATGAACACTCACACGGG
>probe:Drosophila_2:1626039_at:361:525; Interrogation_Position=1075; Antisense; GGGAACCGACCATACAAGTGCAACT
>probe:Drosophila_2:1626039_at:555:219; Interrogation_Position=1090; Antisense; AAGTGCAACTACTGTCCAGCTGCCT
>probe:Drosophila_2:1626039_at:654:109; Interrogation_Position=1147; Antisense; AGAATTCACACTAAGGAGCGTCCCT
>probe:Drosophila_2:1626039_at:461:671; Interrogation_Position=1171; Antisense; TACGTGTGCGACGTTTGCTCCAGAA
>probe:Drosophila_2:1626039_at:542:677; Interrogation_Position=1184; Antisense; TTTGCTCCAGAACGTTTACCTACTC
>probe:Drosophila_2:1626039_at:342:107; Interrogation_Position=1247; Antisense; AGAAGCCGCATGTCTGTGATCTTTG
>probe:Drosophila_2:1626039_at:305:371; Interrogation_Position=1287; Antisense; GAAGGCCTACAAATTGCGTTTGCAT
>probe:Drosophila_2:1626039_at:297:345; Interrogation_Position=1320; Antisense; GCATAATAGACGTATCACCTGGAGA
>probe:Drosophila_2:1626039_at:125:175; Interrogation_Position=1388; Antisense; AAACGCCGGAGTTTCTCAATGAACT
>probe:Drosophila_2:1626039_at:140:655; Interrogation_Position=1471; Antisense; TAAGCCGTTGTTTAAGTTCTTCCAT
>probe:Drosophila_2:1626039_at:497:163; Interrogation_Position=939; Antisense; AAATATCTATCCGACTCAGGCGCGT
>probe:Drosophila_2:1626039_at:229:329; Interrogation_Position=960; Antisense; GCGTCTCACCGAGCACATGAAATTC

Paste this into a BLAST search page for me
GAATCAACAGCTGGTACGGCACATGTACGGCACATGAACACTCACACGGGGGGAACCGACCATACAAGTGCAACTAAGTGCAACTACTGTCCAGCTGCCTAGAATTCACACTAAGGAGCGTCCCTTACGTGTGCGACGTTTGCTCCAGAATTTGCTCCAGAACGTTTACCTACTCAGAAGCCGCATGTCTGTGATCTTTGGAAGGCCTACAAATTGCGTTTGCATGCATAATAGACGTATCACCTGGAGAAAACGCCGGAGTTTCTCAATGAACTTAAGCCGTTGTTTAAGTTCTTCCATAAATATCTATCCGACTCAGGCGCGTGCGTCTCACCGAGCACATGAAATTC

Full Affymetrix probeset data:

Annotations for 1626039_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime