FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626041_at:

>probe:Drosophila_2:1626041_at:208:257; Interrogation_Position=126; Antisense; CAAATCCTGGGCTGTTTTTCATTAT
>probe:Drosophila_2:1626041_at:629:333; Interrogation_Position=136; Antisense; GCTGTTTTTCATTATTGCCGGCTAA
>probe:Drosophila_2:1626041_at:422:315; Interrogation_Position=152; Antisense; GCCGGCTAAAGGCTTACTCGCGTAA
>probe:Drosophila_2:1626041_at:119:247; Interrogation_Position=16; Antisense; AATTCTAACGTTATCCTTCCTGGAG
>probe:Drosophila_2:1626041_at:395:705; Interrogation_Position=165; Antisense; TTACTCGCGTAACAAGACCAGCTTG
>probe:Drosophila_2:1626041_at:580:359; Interrogation_Position=199; Antisense; GCAACATTTCTGCATCCAACGAATA
>probe:Drosophila_2:1626041_at:262:201; Interrogation_Position=215; Antisense; CAACGAATAATGTATCCCTCAGATT
>probe:Drosophila_2:1626041_at:645:31; Interrogation_Position=266; Antisense; ATAAGCCATTTCTCTTCGATGTCAC
>probe:Drosophila_2:1626041_at:277:443; Interrogation_Position=283; Antisense; GATGTCACAATCGACGCCTGCCAAT
>probe:Drosophila_2:1626041_at:722:503; Interrogation_Position=386; Antisense; GTCCTTATGGCTTGCAAGTGGTTAG
>probe:Drosophila_2:1626041_at:124:15; Interrogation_Position=413; Antisense; ATTATCACACCGCTGTATTTCCAGT
>probe:Drosophila_2:1626041_at:541:675; Interrogation_Position=428; Antisense; TATTTCCAGTACCATTACCTTCAGG
>probe:Drosophila_2:1626041_at:168:701; Interrogation_Position=43; Antisense; TTTTTAGCAGCTTTGTTCCTCATCA
>probe:Drosophila_2:1626041_at:527:341; Interrogation_Position=52; Antisense; GCTTTGTTCCTCATCAGCAGTGTAA

Paste this into a BLAST search page for me
CAAATCCTGGGCTGTTTTTCATTATGCTGTTTTTCATTATTGCCGGCTAAGCCGGCTAAAGGCTTACTCGCGTAAAATTCTAACGTTATCCTTCCTGGAGTTACTCGCGTAACAAGACCAGCTTGGCAACATTTCTGCATCCAACGAATACAACGAATAATGTATCCCTCAGATTATAAGCCATTTCTCTTCGATGTCACGATGTCACAATCGACGCCTGCCAATGTCCTTATGGCTTGCAAGTGGTTAGATTATCACACCGCTGTATTTCCAGTTATTTCCAGTACCATTACCTTCAGGTTTTTAGCAGCTTTGTTCCTCATCAGCTTTGTTCCTCATCAGCAGTGTAA

Full Affymetrix probeset data:

Annotations for 1626041_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720