Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626046_s_at:

>probe:Drosophila_2:1626046_s_at:199:583; Interrogation_Position=101; Antisense; TGGCGACTTGAACATCGTGGCTTCT
>probe:Drosophila_2:1626046_s_at:354:571; Interrogation_Position=119; Antisense; GGCTTCTTTCGATCGCAGAGGCAAA
>probe:Drosophila_2:1626046_s_at:95:439; Interrogation_Position=136; Antisense; GAGGCAAACACATCTACACAGGCAA
>probe:Drosophila_2:1626046_s_at:290:391; Interrogation_Position=192; Antisense; GAAACCTTTGAGGTGGTCGCCAGTT
>probe:Drosophila_2:1626046_s_at:168:537; Interrogation_Position=206; Antisense; GGTCGCCAGTTTTCGCATTATTGTA
>probe:Drosophila_2:1626046_s_at:367:717; Interrogation_Position=217; Antisense; TTCGCATTATTGTAGGCACCTCAAG
>probe:Drosophila_2:1626046_s_at:126:355; Interrogation_Position=232; Antisense; GCACCTCAAGTGCAACGGCTGTAAA
>probe:Drosophila_2:1626046_s_at:152:105; Interrogation_Position=281; Antisense; AGACGCATTTCTAATCAACACCTCA
>probe:Drosophila_2:1626046_s_at:136:189; Interrogation_Position=297; Antisense; AACACCTCAGATCGAGTTATTCGTG
>probe:Drosophila_2:1626046_s_at:312:307; Interrogation_Position=352; Antisense; GCAAAGACGGCGAACCGGAACCTAT
>probe:Drosophila_2:1626046_s_at:615:389; Interrogation_Position=413; Antisense; GAAAAAGTGCTGCTTCTCCGGTGAT
>probe:Drosophila_2:1626046_s_at:536:89; Interrogation_Position=442; Antisense; AGTACATTTGCGCTGGCAGTGCTCG
>probe:Drosophila_2:1626046_s_at:488:313; Interrogation_Position=466; Antisense; GCCAGCATGCTCTTTACATATGGGA
>probe:Drosophila_2:1626046_s_at:54:337; Interrogation_Position=79; Antisense; GCTGCCTGCCCTTGGATTCCGATGG

Paste this into a BLAST search page for me
TGGCGACTTGAACATCGTGGCTTCTGGCTTCTTTCGATCGCAGAGGCAAAGAGGCAAACACATCTACACAGGCAAGAAACCTTTGAGGTGGTCGCCAGTTGGTCGCCAGTTTTCGCATTATTGTATTCGCATTATTGTAGGCACCTCAAGGCACCTCAAGTGCAACGGCTGTAAAAGACGCATTTCTAATCAACACCTCAAACACCTCAGATCGAGTTATTCGTGGCAAAGACGGCGAACCGGAACCTATGAAAAAGTGCTGCTTCTCCGGTGATAGTACATTTGCGCTGGCAGTGCTCGGCCAGCATGCTCTTTACATATGGGAGCTGCCTGCCCTTGGATTCCGATGG

Full Affymetrix probeset data:

Annotations for 1626046_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime