FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626047_at:

>probe:Drosophila_2:1626047_at:560:459; Interrogation_Position=1030; Antisense; GATTTGGTCATCAGGAACGCTCCCA
>probe:Drosophila_2:1626047_at:353:191; Interrogation_Position=1090; Antisense; AACATTGTGAGATCCCTGCATGGGT
>probe:Drosophila_2:1626047_at:660:539; Interrogation_Position=1112; Antisense; GGTTTGACAGATCAGCTTCGGGCAT
>probe:Drosophila_2:1626047_at:513:569; Interrogation_Position=1132; Antisense; GGCATATCCCACGTGCTGGAAGTTA
>probe:Drosophila_2:1626047_at:106:531; Interrogation_Position=1158; Antisense; GGGTCACTTATATCTGGGATCGCCT
>probe:Drosophila_2:1626047_at:128:547; Interrogation_Position=1174; Antisense; GGATCGCCTTTCAATCACTATGTTG
>probe:Drosophila_2:1626047_at:300:621; Interrogation_Position=659; Antisense; TGCTCGATGAGTTGTCCTTTGCCAA
>probe:Drosophila_2:1626047_at:237:189; Interrogation_Position=682; Antisense; AACGGCTTGGCCTTAAGTCCCAGTG
>probe:Drosophila_2:1626047_at:410:543; Interrogation_Position=708; Antisense; GGATTTCATTATCCTTGCCGAAACA
>probe:Drosophila_2:1626047_at:569:213; Interrogation_Position=839; Antisense; AAGAGGGAATCTGGGTGCCCCTGTC
>probe:Drosophila_2:1626047_at:668:727; Interrogation_Position=904; Antisense; TTGGCGCCCTATCCGAGGCTTAGAT
>probe:Drosophila_2:1626047_at:587:675; Interrogation_Position=924; Antisense; TAGATCTTTTTTGGCTCGTTTGGTG
>probe:Drosophila_2:1626047_at:197:481; Interrogation_Position=941; Antisense; GTTTGGTGGCTCTAATGCGACTTCC
>probe:Drosophila_2:1626047_at:509:55; Interrogation_Position=995; Antisense; ATGACATTGCGGCTCGTCTTTTTCA

Paste this into a BLAST search page for me
GATTTGGTCATCAGGAACGCTCCCAAACATTGTGAGATCCCTGCATGGGTGGTTTGACAGATCAGCTTCGGGCATGGCATATCCCACGTGCTGGAAGTTAGGGTCACTTATATCTGGGATCGCCTGGATCGCCTTTCAATCACTATGTTGTGCTCGATGAGTTGTCCTTTGCCAAAACGGCTTGGCCTTAAGTCCCAGTGGGATTTCATTATCCTTGCCGAAACAAAGAGGGAATCTGGGTGCCCCTGTCTTGGCGCCCTATCCGAGGCTTAGATTAGATCTTTTTTGGCTCGTTTGGTGGTTTGGTGGCTCTAATGCGACTTCCATGACATTGCGGCTCGTCTTTTTCA

Full Affymetrix probeset data:

Annotations for 1626047_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720