Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626048_at:

>probe:Drosophila_2:1626048_at:10:633; Interrogation_Position=255; Antisense; TCACCCGTTTGGAGAAAGCCGATAT
>probe:Drosophila_2:1626048_at:434:203; Interrogation_Position=270; Antisense; AAGCCGATATCCTGGAACTTACCGT
>probe:Drosophila_2:1626048_at:27:695; Interrogation_Position=288; Antisense; TTACCGTCACCCATTTGCAAAAGAT
>probe:Drosophila_2:1626048_at:90:343; Interrogation_Position=338; Antisense; GCTTCCGGCGATGAGAGCTTGACTC
>probe:Drosophila_2:1626048_at:274:667; Interrogation_Position=386; Antisense; TACATCCATGCCGTCAATGAGGTCT
>probe:Drosophila_2:1626048_at:45:497; Interrogation_Position=443; Antisense; GTCAGCCTAGGCACTCAGCTAATGA
>probe:Drosophila_2:1626048_at:583:527; Interrogation_Position=475; Antisense; GGGACAGCGCCTCAATCAGATCCAG
>probe:Drosophila_2:1626048_at:49:169; Interrogation_Position=508; Antisense; AAAGGAAGTCTTGCCGGTGACCGCT
>probe:Drosophila_2:1626048_at:382:617; Interrogation_Position=543; Antisense; TGCACATCGCCAATCGGGATGCCTA
>probe:Drosophila_2:1626048_at:584:633; Interrogation_Position=638; Antisense; TCCCTGTTGACCACCATCGATGTGA
>probe:Drosophila_2:1626048_at:597:195; Interrogation_Position=695; Antisense; AACGTCTGGCGTCCCTGGTAGATAG
>probe:Drosophila_2:1626048_at:636:457; Interrogation_Position=715; Antisense; GATAGGATTACTTCACACCACAACT
>probe:Drosophila_2:1626048_at:56:215; Interrogation_Position=778; Antisense; AAGTCTTCCGAGTCACTGGATTTCC
>probe:Drosophila_2:1626048_at:321:501; Interrogation_Position=807; Antisense; GTCGACTCCCACCTAGTTATAAGTA

Paste this into a BLAST search page for me
TCACCCGTTTGGAGAAAGCCGATATAAGCCGATATCCTGGAACTTACCGTTTACCGTCACCCATTTGCAAAAGATGCTTCCGGCGATGAGAGCTTGACTCTACATCCATGCCGTCAATGAGGTCTGTCAGCCTAGGCACTCAGCTAATGAGGGACAGCGCCTCAATCAGATCCAGAAAGGAAGTCTTGCCGGTGACCGCTTGCACATCGCCAATCGGGATGCCTATCCCTGTTGACCACCATCGATGTGAAACGTCTGGCGTCCCTGGTAGATAGGATAGGATTACTTCACACCACAACTAAGTCTTCCGAGTCACTGGATTTCCGTCGACTCCCACCTAGTTATAAGTA

Full Affymetrix probeset data:

Annotations for 1626048_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime