FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626049_at:

>probe:Drosophila_2:1626049_at:475:581; Interrogation_Position=1011; Antisense; TGGCCGTTTTTAGGGCGTATCCCAG
>probe:Drosophila_2:1626049_at:179:441; Interrogation_Position=1043; Antisense; GATGTCGGCTTTTATCTGGCCTTGC
>probe:Drosophila_2:1626049_at:512:67; Interrogation_Position=1097; Antisense; ATGGCCCATGGCTTTGTGGTCTTTA
>probe:Drosophila_2:1626049_at:170:519; Interrogation_Position=1112; Antisense; GTGGTCTTTACGTTCTTCCTGGTCA
>probe:Drosophila_2:1626049_at:413:719; Interrogation_Position=1127; Antisense; TTCCTGGTCACTCTATCTATGATGG
>probe:Drosophila_2:1626049_at:57:417; Interrogation_Position=1152; Antisense; GAGCCCTTTGGCATTTGTGGATCTA
>probe:Drosophila_2:1626049_at:612:47; Interrogation_Position=1191; Antisense; ATGCCAATTTCTATTTCGGTGCCAC
>probe:Drosophila_2:1626049_at:425:645; Interrogation_Position=1216; Antisense; TCTTGCGTTTTCCACTGGGCAGATA
>probe:Drosophila_2:1626049_at:363:459; Interrogation_Position=1237; Antisense; GATATTTCTAATCACCGATCTGCTG
>probe:Drosophila_2:1626049_at:40:295; Interrogation_Position=1252; Antisense; CGATCTGCTGTTCGCGCACGTTAAA
>probe:Drosophila_2:1626049_at:159:177; Interrogation_Position=1274; Antisense; AAACGTGAGTTCTGCTTGTTCAATG
>probe:Drosophila_2:1626049_at:215:111; Interrogation_Position=1401; Antisense; AGAATGCGCTTCCTAATGGCAGCCG
>probe:Drosophila_2:1626049_at:647:67; Interrogation_Position=1416; Antisense; ATGGCAGCCGAGCATACTCTTAAGA
>probe:Drosophila_2:1626049_at:7:615; Interrogation_Position=924; Antisense; TGAATGCCACCGTATTATACCTGGT

Paste this into a BLAST search page for me
TGGCCGTTTTTAGGGCGTATCCCAGGATGTCGGCTTTTATCTGGCCTTGCATGGCCCATGGCTTTGTGGTCTTTAGTGGTCTTTACGTTCTTCCTGGTCATTCCTGGTCACTCTATCTATGATGGGAGCCCTTTGGCATTTGTGGATCTAATGCCAATTTCTATTTCGGTGCCACTCTTGCGTTTTCCACTGGGCAGATAGATATTTCTAATCACCGATCTGCTGCGATCTGCTGTTCGCGCACGTTAAAAAACGTGAGTTCTGCTTGTTCAATGAGAATGCGCTTCCTAATGGCAGCCGATGGCAGCCGAGCATACTCTTAAGATGAATGCCACCGTATTATACCTGGT

Full Affymetrix probeset data:

Annotations for 1626049_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720