FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626050_at:

>probe:Drosophila_2:1626050_at:70:491; Interrogation_Position=1652; Antisense; GGAACCAATGGAGCCCAACGGACCG
>probe:Drosophila_2:1626050_at:725:425; Interrogation_Position=1691; Antisense; GAGATGGCCAACTGCGTCAACTCCA
>probe:Drosophila_2:1626050_at:399:141; Interrogation_Position=1715; Antisense; ACGGCCTCGTCGGAGATACACATGA
>probe:Drosophila_2:1626050_at:149:665; Interrogation_Position=1731; Antisense; TACACATGAGCGTGATGCGTGCCCG
>probe:Drosophila_2:1626050_at:98:507; Interrogation_Position=1749; Antisense; GTGCCCGCCAGTATGCCGTCAATGT
>probe:Drosophila_2:1626050_at:716:157; Interrogation_Position=1836; Antisense; ACACATATGGCGTATACTTGATTTC
>probe:Drosophila_2:1626050_at:661:667; Interrogation_Position=1850; Antisense; TACTTGATTTCAACTCCAGTGCTTC
>probe:Drosophila_2:1626050_at:221:85; Interrogation_Position=1867; Antisense; AGTGCTTCACAATGTCTGTTCATGA
>probe:Drosophila_2:1626050_at:505:471; Interrogation_Position=1884; Antisense; GTTCATGAGATGAGTGCGCAGTGCA
>probe:Drosophila_2:1626050_at:412:85; Interrogation_Position=1903; Antisense; AGTGCACAGCAAGTGTTCTCCAGAA
>probe:Drosophila_2:1626050_at:212:389; Interrogation_Position=1925; Antisense; GAAAACCAGATTGCCAGCTTACAAA
>probe:Drosophila_2:1626050_at:293:189; Interrogation_Position=1968; Antisense; AACATTCCTCAAAATGGCTGCTAAG
>probe:Drosophila_2:1626050_at:195:359; Interrogation_Position=2043; Antisense; GCAACAATACGACAATCCCACAGAT
>probe:Drosophila_2:1626050_at:158:81; Interrogation_Position=2156; Antisense; AGGTGTCATGGAGTCAGGAATTTCA

Paste this into a BLAST search page for me
GGAACCAATGGAGCCCAACGGACCGGAGATGGCCAACTGCGTCAACTCCAACGGCCTCGTCGGAGATACACATGATACACATGAGCGTGATGCGTGCCCGGTGCCCGCCAGTATGCCGTCAATGTACACATATGGCGTATACTTGATTTCTACTTGATTTCAACTCCAGTGCTTCAGTGCTTCACAATGTCTGTTCATGAGTTCATGAGATGAGTGCGCAGTGCAAGTGCACAGCAAGTGTTCTCCAGAAGAAAACCAGATTGCCAGCTTACAAAAACATTCCTCAAAATGGCTGCTAAGGCAACAATACGACAATCCCACAGATAGGTGTCATGGAGTCAGGAATTTCA

Full Affymetrix probeset data:

Annotations for 1626050_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720