FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626051_at:

>probe:Drosophila_2:1626051_at:375:453; Interrogation_Position=137; Antisense; GATAATCCCGCCGAGAGTCCCGAAT
>probe:Drosophila_2:1626051_at:717:99; Interrogation_Position=150; Antisense; AGAGTCCCGAATTGCTGCCCACCGA
>probe:Drosophila_2:1626051_at:454:447; Interrogation_Position=173; Antisense; GATGCGAATGCCAAGCGCAGCAAGA
>probe:Drosophila_2:1626051_at:344:179; Interrogation_Position=252; Antisense; AAACAGAGGCGACCAAGTGCAAGAA
>probe:Drosophila_2:1626051_at:569:215; Interrogation_Position=276; Antisense; AAGTTGGACAATTGGGCAGTCCGGC
>probe:Drosophila_2:1626051_at:522:439; Interrogation_Position=350; Antisense; GAGGCGCCGGATGGCAAATCCGCCA
>probe:Drosophila_2:1626051_at:390:633; Interrogation_Position=368; Antisense; TCCGCCAGACGGGATTGCTGCAAAA
>probe:Drosophila_2:1626051_at:720:233; Interrogation_Position=392; Antisense; AATGCCGACATCCTCAACATAGTTT
>probe:Drosophila_2:1626051_at:459:137; Interrogation_Position=430; Antisense; ACGTAGTTTAATGCAGGATCCTGAA
>probe:Drosophila_2:1626051_at:39:217; Interrogation_Position=453; Antisense; AAGTTCAGGCCTTCTGGACCGAAAT
>probe:Drosophila_2:1626051_at:532:553; Interrogation_Position=468; Antisense; GGACCGAAATAACCAATTGCATAAA
>probe:Drosophila_2:1626051_at:304:221; Interrogation_Position=491; Antisense; AAGGGCTGAAAGCTTAACTGATCAT
>probe:Drosophila_2:1626051_at:281:179; Interrogation_Position=82; Antisense; AAACATCAAGGAGCGCCTGAATCTG
>probe:Drosophila_2:1626051_at:370:615; Interrogation_Position=99; Antisense; TGAATCTGCACGTCAAGCGGCGCCT

Paste this into a BLAST search page for me
GATAATCCCGCCGAGAGTCCCGAATAGAGTCCCGAATTGCTGCCCACCGAGATGCGAATGCCAAGCGCAGCAAGAAAACAGAGGCGACCAAGTGCAAGAAAAGTTGGACAATTGGGCAGTCCGGCGAGGCGCCGGATGGCAAATCCGCCATCCGCCAGACGGGATTGCTGCAAAAAATGCCGACATCCTCAACATAGTTTACGTAGTTTAATGCAGGATCCTGAAAAGTTCAGGCCTTCTGGACCGAAATGGACCGAAATAACCAATTGCATAAAAAGGGCTGAAAGCTTAACTGATCATAAACATCAAGGAGCGCCTGAATCTGTGAATCTGCACGTCAAGCGGCGCCT

Full Affymetrix probeset data:

Annotations for 1626051_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720