FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626052_at:

>probe:Drosophila_2:1626052_at:242:457; Interrogation_Position=1014; Antisense; GATACGCCACCCAAAGAAGGACTGT
>probe:Drosophila_2:1626052_at:604:371; Interrogation_Position=1029; Antisense; GAAGGACTGTCACCACCAAACAGAT
>probe:Drosophila_2:1626052_at:131:713; Interrogation_Position=1110; Antisense; TTCTGCTCGAGGACTACTCCAATGG
>probe:Drosophila_2:1626052_at:532:147; Interrogation_Position=1146; Antisense; ACTACATTGCTGGTGTGGTCTCCTA
>probe:Drosophila_2:1626052_at:695:133; Interrogation_Position=1178; Antisense; ACGCCCTGTGGCCTAAAAGGATGGC
>probe:Drosophila_2:1626052_at:550:1; Interrogation_Position=1198; Antisense; ATGGCCCGGCGTGTACACAAGGGTT
>probe:Drosophila_2:1626052_at:582:527; Interrogation_Position=1332; Antisense; GGGACATGCCACAGTAAATATCGAT
>probe:Drosophila_2:1626052_at:694:199; Interrogation_Position=1416; Antisense; AACGCGCAGAGTTCAACACTTCTTG
>probe:Drosophila_2:1626052_at:552:149; Interrogation_Position=1433; Antisense; ACTTCTTGATCTGGTGTACTGTACA
>probe:Drosophila_2:1626052_at:32:159; Interrogation_Position=888; Antisense; ACAACAATATATTCCTTGGCCGAAA
>probe:Drosophila_2:1626052_at:705:535; Interrogation_Position=932; Antisense; GGTCGCACGGAGACAAATTTTACGT
>probe:Drosophila_2:1626052_at:302:245; Interrogation_Position=947; Antisense; AATTTTACGTCCAATATCAAGCTGA
>probe:Drosophila_2:1626052_at:613:283; Interrogation_Position=968; Antisense; CTGAAGGCTGAGTTGGATACGGTAC
>probe:Drosophila_2:1626052_at:417:455; Interrogation_Position=983; Antisense; GATACGGTACCGACGTCCGAATGCA

Paste this into a BLAST search page for me
GATACGCCACCCAAAGAAGGACTGTGAAGGACTGTCACCACCAAACAGATTTCTGCTCGAGGACTACTCCAATGGACTACATTGCTGGTGTGGTCTCCTAACGCCCTGTGGCCTAAAAGGATGGCATGGCCCGGCGTGTACACAAGGGTTGGGACATGCCACAGTAAATATCGATAACGCGCAGAGTTCAACACTTCTTGACTTCTTGATCTGGTGTACTGTACAACAACAATATATTCCTTGGCCGAAAGGTCGCACGGAGACAAATTTTACGTAATTTTACGTCCAATATCAAGCTGACTGAAGGCTGAGTTGGATACGGTACGATACGGTACCGACGTCCGAATGCA

Full Affymetrix probeset data:

Annotations for 1626052_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720