FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626053_at:

>probe:Drosophila_2:1626053_at:526:29; Interrogation_Position=3684; Antisense; ATACTGGGCAAGTCTGGTCTGCGGC
>probe:Drosophila_2:1626053_at:641:535; Interrogation_Position=3699; Antisense; GGTCTGCGGCAGAACACCATGAATG
>probe:Drosophila_2:1626053_at:517:233; Interrogation_Position=3720; Antisense; AATGCGAGTGTAGGTGCTCCCAGCA
>probe:Drosophila_2:1626053_at:348:507; Interrogation_Position=3733; Antisense; GTGCTCCCAGCAACGGGCAGATGGA
>probe:Drosophila_2:1626053_at:575:117; Interrogation_Position=3829; Antisense; AGCTGCTTAACGACTGGGCATCCAG
>probe:Drosophila_2:1626053_at:424:529; Interrogation_Position=3874; Antisense; GGGATTATCATTTCGGCAGCAAGCA
>probe:Drosophila_2:1626053_at:68:111; Interrogation_Position=3903; Antisense; AGCAAGCAGCACCTCTACGTGAAGG
>probe:Drosophila_2:1626053_at:153:225; Interrogation_Position=3930; Antisense; AAGGATGGCACCTGGTCGGCCGTCA
>probe:Drosophila_2:1626053_at:431:35; Interrogation_Position=3967; Antisense; ATCAGTCCTTCAAGCATCAGCAGCA
>probe:Drosophila_2:1626053_at:685:79; Interrogation_Position=4016; Antisense; AGGTGACAACACCAAGTCCCTAGCT
>probe:Drosophila_2:1626053_at:135:333; Interrogation_Position=4056; Antisense; GCTGGCGATAGCAAATTCCTGAGTA
>probe:Drosophila_2:1626053_at:427:305; Interrogation_Position=4073; Antisense; CCTGAGTAGTTTTGGCTCTAGTGCC
>probe:Drosophila_2:1626053_at:640:505; Interrogation_Position=4093; Antisense; GTGCCAATGTCTAGAGTCAACCTTT
>probe:Drosophila_2:1626053_at:206:601; Interrogation_Position=4184; Antisense; TGTAGGCGTGTATATCCGTTTGGCG

Paste this into a BLAST search page for me
ATACTGGGCAAGTCTGGTCTGCGGCGGTCTGCGGCAGAACACCATGAATGAATGCGAGTGTAGGTGCTCCCAGCAGTGCTCCCAGCAACGGGCAGATGGAAGCTGCTTAACGACTGGGCATCCAGGGGATTATCATTTCGGCAGCAAGCAAGCAAGCAGCACCTCTACGTGAAGGAAGGATGGCACCTGGTCGGCCGTCAATCAGTCCTTCAAGCATCAGCAGCAAGGTGACAACACCAAGTCCCTAGCTGCTGGCGATAGCAAATTCCTGAGTACCTGAGTAGTTTTGGCTCTAGTGCCGTGCCAATGTCTAGAGTCAACCTTTTGTAGGCGTGTATATCCGTTTGGCG

Full Affymetrix probeset data:

Annotations for 1626053_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720