FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626054_at:

>probe:Drosophila_2:1626054_at:42:61; Interrogation_Position=13; Antisense; ATGTATAAGCCGGACACGCTCACGC
>probe:Drosophila_2:1626054_at:453:415; Interrogation_Position=136; Antisense; GAGCTACCCGGCCTCGACTATGCGG
>probe:Drosophila_2:1626054_at:680:403; Interrogation_Position=151; Antisense; GACTATGCGGTCCACTCGCAGTCGG
>probe:Drosophila_2:1626054_at:722:633; Interrogation_Position=166; Antisense; TCGCAGTCGGCCTTTGGCGCCTACG
>probe:Drosophila_2:1626054_at:10:625; Interrogation_Position=230; Antisense; TGCGCAGCGGCCTTGCGGCGATCAC
>probe:Drosophila_2:1626054_at:495:329; Interrogation_Position=278; Antisense; GCGGCGTTTCCCAGTCGCAGAGCGC
>probe:Drosophila_2:1626054_at:541:71; Interrogation_Position=296; Antisense; AGAGCGCCCTCCTCGGAAGGTACGG
>probe:Drosophila_2:1626054_at:463:537; Interrogation_Position=314; Antisense; GGTACGGGCCCAACGCCTCGATTCG
>probe:Drosophila_2:1626054_at:148:317; Interrogation_Position=328; Antisense; GCCTCGATTCGCCACGGAGAAAGAA
>probe:Drosophila_2:1626054_at:351:633; Interrogation_Position=336; Antisense; TCGCCACGGAGAAAGAAAGATTGTC
>probe:Drosophila_2:1626054_at:594:167; Interrogation_Position=351; Antisense; AAAGATTGTCCAGCCAAAACGGTAG
>probe:Drosophila_2:1626054_at:115:569; Interrogation_Position=43; Antisense; GGCAGCCTGAGATCCCTGCGCAGCG
>probe:Drosophila_2:1626054_at:352:609; Interrogation_Position=77; Antisense; TGAGCACCGTGCTCGAAAGCACGCT
>probe:Drosophila_2:1626054_at:502:173; Interrogation_Position=92; Antisense; AAAGCACGCTTTCACTGACCCGCAT

Paste this into a BLAST search page for me
ATGTATAAGCCGGACACGCTCACGCGAGCTACCCGGCCTCGACTATGCGGGACTATGCGGTCCACTCGCAGTCGGTCGCAGTCGGCCTTTGGCGCCTACGTGCGCAGCGGCCTTGCGGCGATCACGCGGCGTTTCCCAGTCGCAGAGCGCAGAGCGCCCTCCTCGGAAGGTACGGGGTACGGGCCCAACGCCTCGATTCGGCCTCGATTCGCCACGGAGAAAGAATCGCCACGGAGAAAGAAAGATTGTCAAAGATTGTCCAGCCAAAACGGTAGGGCAGCCTGAGATCCCTGCGCAGCGTGAGCACCGTGCTCGAAAGCACGCTAAAGCACGCTTTCACTGACCCGCAT

Full Affymetrix probeset data:

Annotations for 1626054_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720