FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626055_at:

>probe:Drosophila_2:1626055_at:160:23; Interrogation_Position=234; Antisense; ATATAGCTACATTGAGGTCCACCTC
>probe:Drosophila_2:1626055_at:52:609; Interrogation_Position=246; Antisense; TGAGGTCCACCTCGCATCAAGAAGA
>probe:Drosophila_2:1626055_at:136:525; Interrogation_Position=279; Antisense; GGGCTTTGACATTATAAGGATCTAC
>probe:Drosophila_2:1626055_at:343:559; Interrogation_Position=306; Antisense; GGAAAACTTCCGCTTTCATTATGAT
>probe:Drosophila_2:1626055_at:10:233; Interrogation_Position=331; Antisense; AATGACCATGTAATTGCCCTGGTTA
>probe:Drosophila_2:1626055_at:610:635; Interrogation_Position=381; Antisense; TCGAATGGATCGTGTTCGCGTTCCA
>probe:Drosophila_2:1626055_at:547:327; Interrogation_Position=398; Antisense; GCGTTCCAGCTTATGATACAAGATT
>probe:Drosophila_2:1626055_at:631:639; Interrogation_Position=452; Antisense; TCTGTGGCTACGGAACCGAAAAACG
>probe:Drosophila_2:1626055_at:723:175; Interrogation_Position=472; Antisense; AAACGACATGCTAAGCTGCCCGAAT
>probe:Drosophila_2:1626055_at:3:337; Interrogation_Position=486; Antisense; GCTGCCCGAATGGATGCGTTGCATA
>probe:Drosophila_2:1626055_at:245:573; Interrogation_Position=644; Antisense; GGCCGAATCCAACCTTCATTGGCAT
>probe:Drosophila_2:1626055_at:33:347; Interrogation_Position=665; Antisense; GCATCATATGGCTCATGCCCGAAAA
>probe:Drosophila_2:1626055_at:715:647; Interrogation_Position=677; Antisense; TCATGCCCGAAAACTGCAGCATTGG
>probe:Drosophila_2:1626055_at:388:517; Interrogation_Position=763; Antisense; GTGGGATTCTGTGAGTATTCCAAAT

Paste this into a BLAST search page for me
ATATAGCTACATTGAGGTCCACCTCTGAGGTCCACCTCGCATCAAGAAGAGGGCTTTGACATTATAAGGATCTACGGAAAACTTCCGCTTTCATTATGATAATGACCATGTAATTGCCCTGGTTATCGAATGGATCGTGTTCGCGTTCCAGCGTTCCAGCTTATGATACAAGATTTCTGTGGCTACGGAACCGAAAAACGAAACGACATGCTAAGCTGCCCGAATGCTGCCCGAATGGATGCGTTGCATAGGCCGAATCCAACCTTCATTGGCATGCATCATATGGCTCATGCCCGAAAATCATGCCCGAAAACTGCAGCATTGGGTGGGATTCTGTGAGTATTCCAAAT

Full Affymetrix probeset data:

Annotations for 1626055_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720