FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626058_at:

>probe:Drosophila_2:1626058_at:249:269; Interrogation_Position=1264; Antisense; CATGCAGAGCATAGGATCGGATAGG
>probe:Drosophila_2:1626058_at:405:553; Interrogation_Position=1339; Antisense; GGAGCTGCGCATGCTAAAGCTCATG
>probe:Drosophila_2:1626058_at:635:663; Interrogation_Position=1353; Antisense; TAAAGCTCATGACCCTGATGCGCTA
>probe:Drosophila_2:1626058_at:197:317; Interrogation_Position=1372; Antisense; GCGCTATTCCGATGGCAAGTTGCTA
>probe:Drosophila_2:1626058_at:214:217; Interrogation_Position=1388; Antisense; AAGTTGCTATATCAGCAGCCACCGG
>probe:Drosophila_2:1626058_at:302:127; Interrogation_Position=1404; Antisense; AGCCACCGGCATCGTATTTGCCCAT
>probe:Drosophila_2:1626058_at:501:7; Interrogation_Position=1427; Antisense; ATTCCCCACAGGCAAAACGCTGATT
>probe:Drosophila_2:1626058_at:219:227; Interrogation_Position=1534; Antisense; AATGGCGAAGCTCTTTTGGTTAAAT
>probe:Drosophila_2:1626058_at:596:215; Interrogation_Position=1565; Antisense; AAGTATTACACTTCAACTCCTATGT
>probe:Drosophila_2:1626058_at:513:193; Interrogation_Position=1579; Antisense; AACTCCTATGTATGAAATTCTGCCT
>probe:Drosophila_2:1626058_at:358:705; Interrogation_Position=1673; Antisense; TTACCGGTATATTTTTTCAATGTGA
>probe:Drosophila_2:1626058_at:69:671; Interrogation_Position=1725; Antisense; TACGAGTTTATTCCATTTGCCCTTT
>probe:Drosophila_2:1626058_at:496:9; Interrogation_Position=1734; Antisense; ATTCCATTTGCCCTTTCTAGAAATC
>probe:Drosophila_2:1626058_at:686:493; Interrogation_Position=1794; Antisense; GTAATATCTGGTTCACTGTAACTAA

Paste this into a BLAST search page for me
CATGCAGAGCATAGGATCGGATAGGGGAGCTGCGCATGCTAAAGCTCATGTAAAGCTCATGACCCTGATGCGCTAGCGCTATTCCGATGGCAAGTTGCTAAAGTTGCTATATCAGCAGCCACCGGAGCCACCGGCATCGTATTTGCCCATATTCCCCACAGGCAAAACGCTGATTAATGGCGAAGCTCTTTTGGTTAAATAAGTATTACACTTCAACTCCTATGTAACTCCTATGTATGAAATTCTGCCTTTACCGGTATATTTTTTCAATGTGATACGAGTTTATTCCATTTGCCCTTTATTCCATTTGCCCTTTCTAGAAATCGTAATATCTGGTTCACTGTAACTAA

Full Affymetrix probeset data:

Annotations for 1626058_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720