Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626059_at:

>probe:Drosophila_2:1626059_at:534:371; Interrogation_Position=3326; Antisense; GAAGGCAGCTTATCTGTATCGCGAA
>probe:Drosophila_2:1626059_at:217:117; Interrogation_Position=3332; Antisense; AGCTTATCTGTATCGCGAATGCATA
>probe:Drosophila_2:1626059_at:494:667; Interrogation_Position=3382; Antisense; TAGGTTTCGTTTTCTTCTAAGCTAT
>probe:Drosophila_2:1626059_at:457:403; Interrogation_Position=3435; Antisense; GACTAGCTATTACTTAGACGTTTCA
>probe:Drosophila_2:1626059_at:364:471; Interrogation_Position=3500; Antisense; GTTCTATAGAATAATCAGCGCTGGT
>probe:Drosophila_2:1626059_at:397:261; Interrogation_Position=3515; Antisense; CAGCGCTGGTAGACAAATTGTACTC
>probe:Drosophila_2:1626059_at:571:599; Interrogation_Position=3533; Antisense; TGTACTCGTTTTGAGGTTCGCCCGA
>probe:Drosophila_2:1626059_at:416:541; Interrogation_Position=3547; Antisense; GGTTCGCCCGAGTTATTAGTCACAA
>probe:Drosophila_2:1626059_at:562:659; Interrogation_Position=3583; Antisense; TAAAGGTACGAAAATCCATGGATGT
>probe:Drosophila_2:1626059_at:373:489; Interrogation_Position=3612; Antisense; GTACATGTAAAGCAAAGCGCACCAA
>probe:Drosophila_2:1626059_at:505:205; Interrogation_Position=3626; Antisense; AAGCGCACCAAGTTGTATAGCAAAT
>probe:Drosophila_2:1626059_at:314:17; Interrogation_Position=3691; Antisense; ATTTTCGTGCGATGATTTGGTATGC
>probe:Drosophila_2:1626059_at:689:459; Interrogation_Position=3704; Antisense; GATTTGGTATGCAGATCAGGCGAAA
>probe:Drosophila_2:1626059_at:339:71; Interrogation_Position=3721; Antisense; AGGCGAAATGATGGCCGAGAAAATT

Paste this into a BLAST search page for me
GAAGGCAGCTTATCTGTATCGCGAAAGCTTATCTGTATCGCGAATGCATATAGGTTTCGTTTTCTTCTAAGCTATGACTAGCTATTACTTAGACGTTTCAGTTCTATAGAATAATCAGCGCTGGTCAGCGCTGGTAGACAAATTGTACTCTGTACTCGTTTTGAGGTTCGCCCGAGGTTCGCCCGAGTTATTAGTCACAATAAAGGTACGAAAATCCATGGATGTGTACATGTAAAGCAAAGCGCACCAAAAGCGCACCAAGTTGTATAGCAAATATTTTCGTGCGATGATTTGGTATGCGATTTGGTATGCAGATCAGGCGAAAAGGCGAAATGATGGCCGAGAAAATT

Full Affymetrix probeset data:

Annotations for 1626059_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime