FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626062_at:

>probe:Drosophila_2:1626062_at:425:555; Interrogation_Position=109; Antisense; GGACCTGTCGATCTGTCAACATTTT
>probe:Drosophila_2:1626062_at:689:51; Interrogation_Position=13; Antisense; ATGCAGCACGTTGCCAATTTAATTG
>probe:Drosophila_2:1626062_at:678:691; Interrogation_Position=132; Antisense; TTTGAATCACGGTCTGTCAGATAAC
>probe:Drosophila_2:1626062_at:205:57; Interrogation_Position=160; Antisense; ATGAGAGATCTGAGCGTCACCTTCT
>probe:Drosophila_2:1626062_at:542:609; Interrogation_Position=170; Antisense; TGAGCGTCACCTTCTACGGCAGCAG
>probe:Drosophila_2:1626062_at:195:353; Interrogation_Position=188; Antisense; GCAGCAGCGCCATCAACCGACAGAA
>probe:Drosophila_2:1626062_at:54:643; Interrogation_Position=200; Antisense; TCAACCGACAGAAACTGGGCCTTCT
>probe:Drosophila_2:1626062_at:635:175; Interrogation_Position=211; Antisense; AAACTGGGCCTTCTGGCCCTGAGTT
>probe:Drosophila_2:1626062_at:47:609; Interrogation_Position=230; Antisense; TGAGTTCCGCCACTTTGGCTCTGAG
>probe:Drosophila_2:1626062_at:363:569; Interrogation_Position=246; Antisense; GGCTCTGAGCCTGCTCGTGGCCTAA
>probe:Drosophila_2:1626062_at:316:3; Interrogation_Position=34; Antisense; ATTGGCGGCCTTAACGAAATGATCT
>probe:Drosophila_2:1626062_at:334:315; Interrogation_Position=41; Antisense; GCCTTAACGAAATGATCTGGTATCC
>probe:Drosophila_2:1626062_at:56:347; Interrogation_Position=84; Antisense; GCATCCAAGCATCCGTGGAATGCAT
>probe:Drosophila_2:1626062_at:369:305; Interrogation_Position=96; Antisense; CCGTGGAATGCATGGACCTGTCGAT

Paste this into a BLAST search page for me
GGACCTGTCGATCTGTCAACATTTTATGCAGCACGTTGCCAATTTAATTGTTTGAATCACGGTCTGTCAGATAACATGAGAGATCTGAGCGTCACCTTCTTGAGCGTCACCTTCTACGGCAGCAGGCAGCAGCGCCATCAACCGACAGAATCAACCGACAGAAACTGGGCCTTCTAAACTGGGCCTTCTGGCCCTGAGTTTGAGTTCCGCCACTTTGGCTCTGAGGGCTCTGAGCCTGCTCGTGGCCTAAATTGGCGGCCTTAACGAAATGATCTGCCTTAACGAAATGATCTGGTATCCGCATCCAAGCATCCGTGGAATGCATCCGTGGAATGCATGGACCTGTCGAT

Full Affymetrix probeset data:

Annotations for 1626062_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720