FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626064_at:

>probe:Drosophila_2:1626064_at:223:63; Interrogation_Position=2442; Antisense; ATGTGACGACTTGGTATGTGCCCTC
>probe:Drosophila_2:1626064_at:511:135; Interrogation_Position=2485; Antisense; ACGAATAGGTTTCTCCGTGCTGACG
>probe:Drosophila_2:1626064_at:476:123; Interrogation_Position=2517; Antisense; AGCCCTGGAGTCGATGGTGGACCAT
>probe:Drosophila_2:1626064_at:387:587; Interrogation_Position=2534; Antisense; TGGACCATGCTCAGCCGCAGAAGAT
>probe:Drosophila_2:1626064_at:179:185; Interrogation_Position=2594; Antisense; AAAATGCCTTGGTGCGCACGACATC
>probe:Drosophila_2:1626064_at:515:111; Interrogation_Position=2619; Antisense; AGCAAAGCTGCTCTTCAGACTAGTT
>probe:Drosophila_2:1626064_at:4:123; Interrogation_Position=2645; Antisense; AGCGTCTGGGCAGTGACCGGATCTA
>probe:Drosophila_2:1626064_at:7:291; Interrogation_Position=2662; Antisense; CGGATCTATGCAATGGGCCGCGAGA
>probe:Drosophila_2:1626064_at:165:327; Interrogation_Position=2681; Antisense; GCGAGAGCCGCGACAAGTTTTTTGT
>probe:Drosophila_2:1626064_at:353:595; Interrogation_Position=2703; Antisense; TGTGGTTGGAGCGAATCTTCTTCTC
>probe:Drosophila_2:1626064_at:127:227; Interrogation_Position=2729; Antisense; AAGGCAGTCTAGAGACCCGCAGCTA
>probe:Drosophila_2:1626064_at:484:101; Interrogation_Position=2749; Antisense; AGCTACGCAAAGTCCTTGTTCCGGG
>probe:Drosophila_2:1626064_at:447:263; Interrogation_Position=2797; Antisense; CAGCGGCTGCTTTTGGAGGTGATAC
>probe:Drosophila_2:1626064_at:427:405; Interrogation_Position=2850; Antisense; GACTCTTAGGAGCATCACACGTTGA

Paste this into a BLAST search page for me
ATGTGACGACTTGGTATGTGCCCTCACGAATAGGTTTCTCCGTGCTGACGAGCCCTGGAGTCGATGGTGGACCATTGGACCATGCTCAGCCGCAGAAGATAAAATGCCTTGGTGCGCACGACATCAGCAAAGCTGCTCTTCAGACTAGTTAGCGTCTGGGCAGTGACCGGATCTACGGATCTATGCAATGGGCCGCGAGAGCGAGAGCCGCGACAAGTTTTTTGTTGTGGTTGGAGCGAATCTTCTTCTCAAGGCAGTCTAGAGACCCGCAGCTAAGCTACGCAAAGTCCTTGTTCCGGGCAGCGGCTGCTTTTGGAGGTGATACGACTCTTAGGAGCATCACACGTTGA

Full Affymetrix probeset data:

Annotations for 1626064_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720