FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626065_at:

>probe:Drosophila_2:1626065_at:269:403; Interrogation_Position=109; Antisense; GACTTACCACGATTTTCCTCGATTT
>probe:Drosophila_2:1626065_at:693:3; Interrogation_Position=160; Antisense; ATTGTGCTCATTGTGCCCAAATGTC
>probe:Drosophila_2:1626065_at:166:477; Interrogation_Position=191; Antisense; GTTTCCATTTGGCAAACTGGCACCA
>probe:Drosophila_2:1626065_at:55:567; Interrogation_Position=209; Antisense; GGCACCATCAGGTCGCCTGGATTAA
>probe:Drosophila_2:1626065_at:558:249; Interrogation_Position=243; Antisense; CAAGGCAATTCTGGCCATTCACGAG
>probe:Drosophila_2:1626065_at:412:577; Interrogation_Position=28; Antisense; GGCGCTGTCATCAACTCAACAACAA
>probe:Drosophila_2:1626065_at:420:451; Interrogation_Position=286; Antisense; GATCGATTATCGGTGCAGCACAACG
>probe:Drosophila_2:1626065_at:195:199; Interrogation_Position=307; Antisense; AACGACTACAACACATGGACGCTCA
>probe:Drosophila_2:1626065_at:305:411; Interrogation_Position=324; Antisense; GACGCTCAACATACGCGGCGTCAAA
>probe:Drosophila_2:1626065_at:429:437; Interrogation_Position=352; Antisense; GAGGACGCCGGCAAATACATGTGTC
>probe:Drosophila_2:1626065_at:440:63; Interrogation_Position=370; Antisense; ATGTGTCAGGTCAACACGGATCCCA
>probe:Drosophila_2:1626065_at:330:601; Interrogation_Position=410; Antisense; TAATAAATGTCGCTGCCACCGGTTA
>probe:Drosophila_2:1626065_at:558:309; Interrogation_Position=424; Antisense; GCCACCGGTTACTCTGCAAAGTTGA
>probe:Drosophila_2:1626065_at:726:157; Interrogation_Position=49; Antisense; ACAACAATGGTCATCCCTTTATCCC

Paste this into a BLAST search page for me
GACTTACCACGATTTTCCTCGATTTATTGTGCTCATTGTGCCCAAATGTCGTTTCCATTTGGCAAACTGGCACCAGGCACCATCAGGTCGCCTGGATTAACAAGGCAATTCTGGCCATTCACGAGGGCGCTGTCATCAACTCAACAACAAGATCGATTATCGGTGCAGCACAACGAACGACTACAACACATGGACGCTCAGACGCTCAACATACGCGGCGTCAAAGAGGACGCCGGCAAATACATGTGTCATGTGTCAGGTCAACACGGATCCCATAATAAATGTCGCTGCCACCGGTTAGCCACCGGTTACTCTGCAAAGTTGAACAACAATGGTCATCCCTTTATCCC

Full Affymetrix probeset data:

Annotations for 1626065_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720