FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626066_at:

>probe:Drosophila_2:1626066_at:692:451; Interrogation_Position=443; Antisense; GATCGGATCCTCTAACGCTGGAGCT
>probe:Drosophila_2:1626066_at:425:333; Interrogation_Position=459; Antisense; GCTGGAGCTGAATTTGCCGCAGACT
>probe:Drosophila_2:1626066_at:240:103; Interrogation_Position=479; Antisense; AGACTGGCTTTGTGCCTGGTCAGAC
>probe:Drosophila_2:1626066_at:319:407; Interrogation_Position=501; Antisense; GACGGTACCCGCAAATGTTCTGATT
>probe:Drosophila_2:1626066_at:558:473; Interrogation_Position=602; Antisense; GTTCAGGTTCCAAGTGCGAGCGCAA
>probe:Drosophila_2:1626066_at:220:415; Interrogation_Position=619; Antisense; GAGCGCAAGTCCGTGGCCAAGTTAA
>probe:Drosophila_2:1626066_at:416:403; Interrogation_Position=682; Antisense; GACTTCCAACTGATGATACCCTCTA
>probe:Drosophila_2:1626066_at:43:649; Interrogation_Position=715; Antisense; TCATGTTTCCATCTGTGCCGCATTA
>probe:Drosophila_2:1626066_at:23:457; Interrogation_Position=749; Antisense; GATACCAGATCGAGGTTGTGGCCAA
>probe:Drosophila_2:1626066_at:267:383; Interrogation_Position=797; Antisense; GAACTCTGATAATGCCGGTGACTAT
>probe:Drosophila_2:1626066_at:686:277; Interrogation_Position=818; Antisense; CTATTTGTGGTGTTCCGATATCGCC
>probe:Drosophila_2:1626066_at:197:23; Interrogation_Position=835; Antisense; ATATCGCCGTCAGCGGTGCAATATA
>probe:Drosophila_2:1626066_at:103:101; Interrogation_Position=918; Antisense; AGAGGGAGCTTTTGCTCCAGCTGCT
>probe:Drosophila_2:1626066_at:10:449; Interrogation_Position=965; Antisense; GATCCACACTATGTAAGCTGTCCTT

Paste this into a BLAST search page for me
GATCGGATCCTCTAACGCTGGAGCTGCTGGAGCTGAATTTGCCGCAGACTAGACTGGCTTTGTGCCTGGTCAGACGACGGTACCCGCAAATGTTCTGATTGTTCAGGTTCCAAGTGCGAGCGCAAGAGCGCAAGTCCGTGGCCAAGTTAAGACTTCCAACTGATGATACCCTCTATCATGTTTCCATCTGTGCCGCATTAGATACCAGATCGAGGTTGTGGCCAAGAACTCTGATAATGCCGGTGACTATCTATTTGTGGTGTTCCGATATCGCCATATCGCCGTCAGCGGTGCAATATAAGAGGGAGCTTTTGCTCCAGCTGCTGATCCACACTATGTAAGCTGTCCTT

Full Affymetrix probeset data:

Annotations for 1626066_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720