Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626067_a_at:

>probe:Drosophila_2:1626067_a_at:423:559; Interrogation_Position=295; Antisense; GGAAACCACTGTTGCGCAATGAAGG
>probe:Drosophila_2:1626067_a_at:171:233; Interrogation_Position=312; Antisense; AATGAAGGTGGTACCATCTCGCGCG
>probe:Drosophila_2:1626067_a_at:684:37; Interrogation_Position=327; Antisense; ATCTCGCGCGGAGCACGTAAATGCA
>probe:Drosophila_2:1626067_a_at:132:411; Interrogation_Position=418; Antisense; GACGCAGCGTGTCGTGGTCTTAAAA
>probe:Drosophila_2:1626067_a_at:98:693; Interrogation_Position=466; Antisense; TTTGCAAGCGGCTCTAGTTCGCGAA
>probe:Drosophila_2:1626067_a_at:125:207; Interrogation_Position=496; Antisense; AAGCTGATCGATGGCAGTGGTTCAT
>probe:Drosophila_2:1626067_a_at:580:83; Interrogation_Position=511; Antisense; AGTGGTTCATATCTGGGCACTGCCC
>probe:Drosophila_2:1626067_a_at:96:513; Interrogation_Position=592; Antisense; GTGACCATGCTGAAGAACGCTCCGC
>probe:Drosophila_2:1626067_a_at:690:271; Interrogation_Position=642; Antisense; CATACCCATCTACAGTTTTTTGCAG
>probe:Drosophila_2:1626067_a_at:538:545; Interrogation_Position=708; Antisense; GGATCGCACATCATCTCCAGGGAGG
>probe:Drosophila_2:1626067_a_at:76:439; Interrogation_Position=729; Antisense; GAGGCCACCATGTATGAGTTTCCGC
>probe:Drosophila_2:1626067_a_at:676:695; Interrogation_Position=747; Antisense; TTTCCGCTGCTAAAAACCGATGGCC
>probe:Drosophila_2:1626067_a_at:698:633; Interrogation_Position=773; Antisense; TCGCGGTGGCGTCGTCTACTATGAT
>probe:Drosophila_2:1626067_a_at:285:597; Interrogation_Position=820; Antisense; TGTGCGTCGCATTGGTGATGACCGC

Paste this into a BLAST search page for me
GGAAACCACTGTTGCGCAATGAAGGAATGAAGGTGGTACCATCTCGCGCGATCTCGCGCGGAGCACGTAAATGCAGACGCAGCGTGTCGTGGTCTTAAAATTTGCAAGCGGCTCTAGTTCGCGAAAAGCTGATCGATGGCAGTGGTTCATAGTGGTTCATATCTGGGCACTGCCCGTGACCATGCTGAAGAACGCTCCGCCATACCCATCTACAGTTTTTTGCAGGGATCGCACATCATCTCCAGGGAGGGAGGCCACCATGTATGAGTTTCCGCTTTCCGCTGCTAAAAACCGATGGCCTCGCGGTGGCGTCGTCTACTATGATTGTGCGTCGCATTGGTGATGACCGC

Full Affymetrix probeset data:

Annotations for 1626067_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime