FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626068_at:

>probe:Drosophila_2:1626068_at:446:335; Interrogation_Position=1004; Antisense; GCTGAAGCCCACAACTATTATCGAT
>probe:Drosophila_2:1626068_at:120:313; Interrogation_Position=457; Antisense; GCCACGAGCGGCAATACTTCATCTG
>probe:Drosophila_2:1626068_at:254:241; Interrogation_Position=469; Antisense; AATACTTCATCTGCTCGGAACGCTA
>probe:Drosophila_2:1626068_at:730:661; Interrogation_Position=492; Antisense; TACTGCCAGGGCACGGATAGTGGCA
>probe:Drosophila_2:1626068_at:5:361; Interrogation_Position=514; Antisense; GCAAGAAGCCGAAGCACCACAGTCA
>probe:Drosophila_2:1626068_at:377:377; Interrogation_Position=524; Antisense; GAAGCACCACAGTCACGAGCACTTG
>probe:Drosophila_2:1626068_at:117:717; Interrogation_Position=555; Antisense; TTCCACCACGACATTGGCGGAAGTG
>probe:Drosophila_2:1626068_at:8:575; Interrogation_Position=686; Antisense; GGCGCTCGACGTGCCCGATGACGAT
>probe:Drosophila_2:1626068_at:582:453; Interrogation_Position=708; Antisense; GATCAACCTGGTCAGAATGGCGTCT
>probe:Drosophila_2:1626068_at:32:493; Interrogation_Position=718; Antisense; GTCAGAATGGCGTCTCGGTGACACC
>probe:Drosophila_2:1626068_at:566:157; Interrogation_Position=756; Antisense; ACAAATACCGTTGGCGGAACTGGTG
>probe:Drosophila_2:1626068_at:665:553; Interrogation_Position=810; Antisense; GGAGCTGAAGCTGTTTCTCCAGCAG
>probe:Drosophila_2:1626068_at:681:109; Interrogation_Position=836; Antisense; AGAAGGAGCCGCACCCGCCGGAGCA
>probe:Drosophila_2:1626068_at:223:39; Interrogation_Position=986; Antisense; ATCTCCACAACTTGCCCAGCTGAAG

Paste this into a BLAST search page for me
GCTGAAGCCCACAACTATTATCGATGCCACGAGCGGCAATACTTCATCTGAATACTTCATCTGCTCGGAACGCTATACTGCCAGGGCACGGATAGTGGCAGCAAGAAGCCGAAGCACCACAGTCAGAAGCACCACAGTCACGAGCACTTGTTCCACCACGACATTGGCGGAAGTGGGCGCTCGACGTGCCCGATGACGATGATCAACCTGGTCAGAATGGCGTCTGTCAGAATGGCGTCTCGGTGACACCACAAATACCGTTGGCGGAACTGGTGGGAGCTGAAGCTGTTTCTCCAGCAGAGAAGGAGCCGCACCCGCCGGAGCAATCTCCACAACTTGCCCAGCTGAAG

Full Affymetrix probeset data:

Annotations for 1626068_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720