FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626069_at:

>probe:Drosophila_2:1626069_at:325:303; Interrogation_Position=1461; Antisense; CCGGTCGCCACATGAAACTTATCAG
>probe:Drosophila_2:1626069_at:437:245; Interrogation_Position=1506; Antisense; AATTCAGCTCCACAGTCGAGTTCAT
>probe:Drosophila_2:1626069_at:63:289; Interrogation_Position=1540; Antisense; CGGCCTGCACTTGTTGAATTTCGAT
>probe:Drosophila_2:1626069_at:48:629; Interrogation_Position=1590; Antisense; TGCCAAAATCTTACTGCTGCCAATC
>probe:Drosophila_2:1626069_at:647:335; Interrogation_Position=1605; Antisense; GCTGCCAATCTTACTTGCCAATATG
>probe:Drosophila_2:1626069_at:182:139; Interrogation_Position=1634; Antisense; ACGTATTCACTGTTCGTTTGACTAA
>probe:Drosophila_2:1626069_at:509:161; Interrogation_Position=1659; Antisense; AAATTGCTCACTTAACGATCGTTGT
>probe:Drosophila_2:1626069_at:575:361; Interrogation_Position=1711; Antisense; GCAATGGTGCTTCATGGCTTTGATT
>probe:Drosophila_2:1626069_at:156:667; Interrogation_Position=1736; Antisense; TACAGTCAAGATACGCTGCGGCGCA
>probe:Drosophila_2:1626069_at:662:473; Interrogation_Position=1764; Antisense; GTTCACCGCAATTCTGTTTTCGATT
>probe:Drosophila_2:1626069_at:125:477; Interrogation_Position=1779; Antisense; GTTTTCGATTATGCGCCTCATGGCT
>probe:Drosophila_2:1626069_at:9:571; Interrogation_Position=1800; Antisense; GGCTTTCGGCGGTCATAAGACTTCA
>probe:Drosophila_2:1626069_at:368:685; Interrogation_Position=1955; Antisense; TATCTTGCGCTTGCATCTTGTATCT
>probe:Drosophila_2:1626069_at:512:37; Interrogation_Position=1969; Antisense; ATCTTGTATCTTTTGCTGCCGAGCG

Paste this into a BLAST search page for me
CCGGTCGCCACATGAAACTTATCAGAATTCAGCTCCACAGTCGAGTTCATCGGCCTGCACTTGTTGAATTTCGATTGCCAAAATCTTACTGCTGCCAATCGCTGCCAATCTTACTTGCCAATATGACGTATTCACTGTTCGTTTGACTAAAAATTGCTCACTTAACGATCGTTGTGCAATGGTGCTTCATGGCTTTGATTTACAGTCAAGATACGCTGCGGCGCAGTTCACCGCAATTCTGTTTTCGATTGTTTTCGATTATGCGCCTCATGGCTGGCTTTCGGCGGTCATAAGACTTCATATCTTGCGCTTGCATCTTGTATCTATCTTGTATCTTTTGCTGCCGAGCG

Full Affymetrix probeset data:

Annotations for 1626069_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720