Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626072_at:

>probe:Drosophila_2:1626072_at:45:457; Interrogation_Position=1893; Antisense; GATACTAATAGTCAAGGCACGCCCC
>probe:Drosophila_2:1626072_at:418:123; Interrogation_Position=1952; Antisense; AGCGCGTCCTAGTCCATACTGAGAG
>probe:Drosophila_2:1626072_at:586:297; Interrogation_Position=1991; Antisense; CGCAAAATTTCTTCGAGGGCATCTA
>probe:Drosophila_2:1626072_at:293:559; Interrogation_Position=2031; Antisense; GGACACATCGCTTCGCAATGCCAAG
>probe:Drosophila_2:1626072_at:120:375; Interrogation_Position=2058; Antisense; GAAGATCCGCAGCATCAAGAGCACG
>probe:Drosophila_2:1626072_at:445:371; Interrogation_Position=2094; Antisense; GAAGGACTCCACCAATTATGCCCAA
>probe:Drosophila_2:1626072_at:427:437; Interrogation_Position=2203; Antisense; GAGGAGCCCGTTAATATCTTTGAGC
>probe:Drosophila_2:1626072_at:91:419; Interrogation_Position=2224; Antisense; GAGCTTGAAGGCGACTATACCGAGT
>probe:Drosophila_2:1626072_at:550:99; Interrogation_Position=2266; Antisense; AGAGAGCCAAGTGCCGATTTCGAAG
>probe:Drosophila_2:1626072_at:417:689; Interrogation_Position=2323; Antisense; TATTATTCTGGCTACTCGAGGGCTT
>probe:Drosophila_2:1626072_at:568:433; Interrogation_Position=2340; Antisense; GAGGGCTTCAACACGTCGCTATGAA
>probe:Drosophila_2:1626072_at:401:213; Interrogation_Position=2364; Antisense; AAGTAAGTTGTCACGACCGACCGAT
>probe:Drosophila_2:1626072_at:388:555; Interrogation_Position=2390; Antisense; GGACCCATCGGTCTGGAGTAGTTAA
>probe:Drosophila_2:1626072_at:637:589; Interrogation_Position=2433; Antisense; TGGGTTAGTGGAAGCCATCCTCTGA

Paste this into a BLAST search page for me
GATACTAATAGTCAAGGCACGCCCCAGCGCGTCCTAGTCCATACTGAGAGCGCAAAATTTCTTCGAGGGCATCTAGGACACATCGCTTCGCAATGCCAAGGAAGATCCGCAGCATCAAGAGCACGGAAGGACTCCACCAATTATGCCCAAGAGGAGCCCGTTAATATCTTTGAGCGAGCTTGAAGGCGACTATACCGAGTAGAGAGCCAAGTGCCGATTTCGAAGTATTATTCTGGCTACTCGAGGGCTTGAGGGCTTCAACACGTCGCTATGAAAAGTAAGTTGTCACGACCGACCGATGGACCCATCGGTCTGGAGTAGTTAATGGGTTAGTGGAAGCCATCCTCTGA

Full Affymetrix probeset data:

Annotations for 1626072_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime