FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626074_at:

>probe:Drosophila_2:1626074_at:665:589; Interrogation_Position=1031; Antisense; TGGTTCACGCCAATCAGGGATCTCA
>probe:Drosophila_2:1626074_at:351:267; Interrogation_Position=1045; Antisense; CAGGGATCTCATGGCGTTTTACCAG
>probe:Drosophila_2:1626074_at:498:475; Interrogation_Position=1060; Antisense; GTTTTACCAGGTAGCGTTCCAGCGC
>probe:Drosophila_2:1626074_at:325:469; Interrogation_Position=1075; Antisense; GTTCCAGCGCAAGATTCAGGTCCTT
>probe:Drosophila_2:1626074_at:144:431; Interrogation_Position=1136; Antisense; GAGTAACTGGCGTTCTTCAACCAAA
>probe:Drosophila_2:1626074_at:39:665; Interrogation_Position=1181; Antisense; TAAATCCACCATTTGTCATTGGCAA
>probe:Drosophila_2:1626074_at:120:685; Interrogation_Position=1231; Antisense; TATAATGCAACAGTCCCTGGCAGGA
>probe:Drosophila_2:1626074_at:571:613; Interrogation_Position=701; Antisense; TGAACTGCTTTGGTAACTGTCCCAC
>probe:Drosophila_2:1626074_at:367:241; Interrogation_Position=734; Antisense; AATACAATCCCATTTGCGGCAGCAA
>probe:Drosophila_2:1626074_at:298:243; Interrogation_Position=785; Antisense; AATTTAATTGTGCTCGTTTCTGTGG
>probe:Drosophila_2:1626074_at:80:17; Interrogation_Position=820; Antisense; ATTTTTGGGCATCTGCAGTTCCAGT
>probe:Drosophila_2:1626074_at:73:95; Interrogation_Position=836; Antisense; AGTTCCAGTCCACGGTGTTAGCTGA
>probe:Drosophila_2:1626074_at:22:687; Interrogation_Position=904; Antisense; TATAGCGGTGTATACAACCACTCGA
>probe:Drosophila_2:1626074_at:700:265; Interrogation_Position=991; Antisense; CAGGCACCCGGATTTATAATACCAT

Paste this into a BLAST search page for me
TGGTTCACGCCAATCAGGGATCTCACAGGGATCTCATGGCGTTTTACCAGGTTTTACCAGGTAGCGTTCCAGCGCGTTCCAGCGCAAGATTCAGGTCCTTGAGTAACTGGCGTTCTTCAACCAAATAAATCCACCATTTGTCATTGGCAATATAATGCAACAGTCCCTGGCAGGATGAACTGCTTTGGTAACTGTCCCACAATACAATCCCATTTGCGGCAGCAAAATTTAATTGTGCTCGTTTCTGTGGATTTTTGGGCATCTGCAGTTCCAGTAGTTCCAGTCCACGGTGTTAGCTGATATAGCGGTGTATACAACCACTCGACAGGCACCCGGATTTATAATACCAT

Full Affymetrix probeset data:

Annotations for 1626074_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720