FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626075_at:

>probe:Drosophila_2:1626075_at:542:643; Interrogation_Position=182; Antisense; TCTTAACGGTGGCTCACTGTTTTAA
>probe:Drosophila_2:1626075_at:681:371; Interrogation_Position=306; Antisense; GAAGTTTTCACCTCTAACCCTGCGA
>probe:Drosophila_2:1626075_at:105:621; Interrogation_Position=344; Antisense; TGCTGAGGGTCAAGGCGGCCATATC
>probe:Drosophila_2:1626075_at:76:23; Interrogation_Position=364; Antisense; ATATCGCATTCCCACATGATCAACT
>probe:Drosophila_2:1626075_at:395:59; Interrogation_Position=379; Antisense; ATGATCAACTACATCGGCCTCTGCT
>probe:Drosophila_2:1626075_at:456:709; Interrogation_Position=422; Antisense; TTAACATGTTCGCACCGCCGCAGGA
>probe:Drosophila_2:1626075_at:650:303; Interrogation_Position=439; Antisense; CCGCAGGAGCTTGCAGGCTGGAATT
>probe:Drosophila_2:1626075_at:259:365; Interrogation_Position=459; Antisense; GAATTTGATGCATATCGCTCAGCCC
>probe:Drosophila_2:1626075_at:527:649; Interrogation_Position=477; Antisense; TCAGCCCCTGAAATCTATGAGTGTT
>probe:Drosophila_2:1626075_at:495:175; Interrogation_Position=519; Antisense; AAACTGTCGTCAATGGTTTCCCCAG
>probe:Drosophila_2:1626075_at:300:217; Interrogation_Position=632; Antisense; AAGTATGCGGCCTGGCAATAGCCTT
>probe:Drosophila_2:1626075_at:389:213; Interrogation_Position=648; Antisense; AATAGCCTTTCGAAAATGCGGAGAT
>probe:Drosophila_2:1626075_at:15:551; Interrogation_Position=667; Antisense; GGAGATAAGCGATATCCCGCCCTCT
>probe:Drosophila_2:1626075_at:572:1; Interrogation_Position=718; Antisense; TTTATTGCCCAAGCCGTACTAACCT

Paste this into a BLAST search page for me
TCTTAACGGTGGCTCACTGTTTTAAGAAGTTTTCACCTCTAACCCTGCGATGCTGAGGGTCAAGGCGGCCATATCATATCGCATTCCCACATGATCAACTATGATCAACTACATCGGCCTCTGCTTTAACATGTTCGCACCGCCGCAGGACCGCAGGAGCTTGCAGGCTGGAATTGAATTTGATGCATATCGCTCAGCCCTCAGCCCCTGAAATCTATGAGTGTTAAACTGTCGTCAATGGTTTCCCCAGAAGTATGCGGCCTGGCAATAGCCTTAATAGCCTTTCGAAAATGCGGAGATGGAGATAAGCGATATCCCGCCCTCTTTTATTGCCCAAGCCGTACTAACCT

Full Affymetrix probeset data:

Annotations for 1626075_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720