FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626076_at:

>probe:Drosophila_2:1626076_at:92:429; Interrogation_Position=1058; Antisense; GAGTAGGCCCTATCATGTATCAAAC
>probe:Drosophila_2:1626076_at:117:391; Interrogation_Position=608; Antisense; GAAACTTAACCAGCTGACTGCACAA
>probe:Drosophila_2:1626076_at:63:103; Interrogation_Position=632; Antisense; AGAGCGATTGGAACTGCGGGCCAAA
>probe:Drosophila_2:1626076_at:254:521; Interrogation_Position=702; Antisense; GTGGCAGTGGCCATCAATAAATCCT
>probe:Drosophila_2:1626076_at:103:241; Interrogation_Position=717; Antisense; AATAAATCCTCTAGTGCCTCCATTA
>probe:Drosophila_2:1626076_at:660:505; Interrogation_Position=730; Antisense; GTGCCTCCATTACGGCCAACAAAGG
>probe:Drosophila_2:1626076_at:667:197; Interrogation_Position=796; Antisense; AACGTGCCGAGCGTTTCGGATTCGT
>probe:Drosophila_2:1626076_at:452:637; Interrogation_Position=811; Antisense; TCGGATTCGTGGTGCCTGACAAAGC
>probe:Drosophila_2:1626076_at:105:173; Interrogation_Position=831; Antisense; AAAGCACCGACCTCAAAGGCCGATG
>probe:Drosophila_2:1626076_at:276:257; Interrogation_Position=844; Antisense; CAAAGGCCGATGATCGTCTCCAGAA
>probe:Drosophila_2:1626076_at:471:691; Interrogation_Position=882; Antisense; TTTGGAGCAGGAGCAGTCTCAGCAG
>probe:Drosophila_2:1626076_at:324:195; Interrogation_Position=926; Antisense; AACTGAATCCAAGGACGCCTGGTCA
>probe:Drosophila_2:1626076_at:709:299; Interrogation_Position=958; Antisense; CGCGCGCTCGCTTGGAAAGATTCAA
>probe:Drosophila_2:1626076_at:622:387; Interrogation_Position=972; Antisense; GAAAGATTCAAAACAGCCCCGTCCA

Paste this into a BLAST search page for me
GAGTAGGCCCTATCATGTATCAAACGAAACTTAACCAGCTGACTGCACAAAGAGCGATTGGAACTGCGGGCCAAAGTGGCAGTGGCCATCAATAAATCCTAATAAATCCTCTAGTGCCTCCATTAGTGCCTCCATTACGGCCAACAAAGGAACGTGCCGAGCGTTTCGGATTCGTTCGGATTCGTGGTGCCTGACAAAGCAAAGCACCGACCTCAAAGGCCGATGCAAAGGCCGATGATCGTCTCCAGAATTTGGAGCAGGAGCAGTCTCAGCAGAACTGAATCCAAGGACGCCTGGTCACGCGCGCTCGCTTGGAAAGATTCAAGAAAGATTCAAAACAGCCCCGTCCA

Full Affymetrix probeset data:

Annotations for 1626076_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720