FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626081_at:

>probe:Drosophila_2:1626081_at:294:569; Interrogation_Position=1014; Antisense; GGCAGTCATTGCATTGGCTCTATTC
>probe:Drosophila_2:1626081_at:683:571; Interrogation_Position=1029; Antisense; GGCTCTATTCAAGGCTTACGGACAT
>probe:Drosophila_2:1626081_at:222:671; Interrogation_Position=1045; Antisense; TACGGACATCTTTGGCTGCTGGGCA
>probe:Drosophila_2:1626081_at:578:95; Interrogation_Position=1077; Antisense; AGATCGGTATCTGCCCATTATTCTG
>probe:Drosophila_2:1626081_at:55:339; Interrogation_Position=1117; Antisense; GCTCTTGTCAGCTTTGGCCTTTATC
>probe:Drosophila_2:1626081_at:278:705; Interrogation_Position=1157; Antisense; TTAGCAGCGAAGTTCTGCCCACGAA
>probe:Drosophila_2:1626081_at:302:137; Interrogation_Position=1187; Antisense; ACGACTTGCTCTACTCATTGGCATC
>probe:Drosophila_2:1626081_at:563:271; Interrogation_Position=1250; Antisense; CATTCAATGCGGTTAAGGCCACAAT
>probe:Drosophila_2:1626081_at:574:333; Interrogation_Position=1284; Antisense; GCTGCTTCTCTATCTGTGGGTCTTT
>probe:Drosophila_2:1626081_at:253:695; Interrogation_Position=1306; Antisense; TTTGCCGGAGCCTCAATATTCGTGG
>probe:Drosophila_2:1626081_at:140:243; Interrogation_Position=1320; Antisense; AATATTCGTGGGTCTTATCTCGCTG
>probe:Drosophila_2:1626081_at:675:449; Interrogation_Position=1430; Antisense; GATCGGCGGTTACGAACGGACACAT
>probe:Drosophila_2:1626081_at:74:249; Interrogation_Position=900; Antisense; CAATTACGTGGTTTTGGCCAGCGCC
>probe:Drosophila_2:1626081_at:668:479; Interrogation_Position=965; Antisense; GTTTGCCGCGAAAGCTCCTGCTGTG

Paste this into a BLAST search page for me
GGCAGTCATTGCATTGGCTCTATTCGGCTCTATTCAAGGCTTACGGACATTACGGACATCTTTGGCTGCTGGGCAAGATCGGTATCTGCCCATTATTCTGGCTCTTGTCAGCTTTGGCCTTTATCTTAGCAGCGAAGTTCTGCCCACGAAACGACTTGCTCTACTCATTGGCATCCATTCAATGCGGTTAAGGCCACAATGCTGCTTCTCTATCTGTGGGTCTTTTTTGCCGGAGCCTCAATATTCGTGGAATATTCGTGGGTCTTATCTCGCTGGATCGGCGGTTACGAACGGACACATCAATTACGTGGTTTTGGCCAGCGCCGTTTGCCGCGAAAGCTCCTGCTGTG

Full Affymetrix probeset data:

Annotations for 1626081_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720