FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626082_at:

>probe:Drosophila_2:1626082_at:404:605; Interrogation_Position=363; Antisense; TGATTTGCAGCGCTCCCAAGGTGGA
>probe:Drosophila_2:1626082_at:463:587; Interrogation_Position=384; Antisense; TGGAGCTGTTCATTGGACCCTTGCA
>probe:Drosophila_2:1626082_at:726:549; Interrogation_Position=409; Antisense; GGAGTACTGCGAGACCATCTACGGC
>probe:Drosophila_2:1626082_at:208:671; Interrogation_Position=428; Antisense; TACGGCACTTGCGTCGACGATGAGG
>probe:Drosophila_2:1626082_at:28:297; Interrogation_Position=470; Antisense; CGACCCTATCGCTATGACATGGAAA
>probe:Drosophila_2:1626082_at:515:661; Interrogation_Position=519; Antisense; TAAACCTGAAGATGCTCACCTCGGC
>probe:Drosophila_2:1626082_at:467:427; Interrogation_Position=548; Antisense; GAGATCTGCGTTTACGGAGCCCTGC
>probe:Drosophila_2:1626082_at:16:309; Interrogation_Position=615; Antisense; CCAGGCCAATGGATGCGCAGCGAAT
>probe:Drosophila_2:1626082_at:42:217; Interrogation_Position=698; Antisense; AAGTTCGAGCAGTTCATGAGCCTGA
>probe:Drosophila_2:1626082_at:720:605; Interrogation_Position=720; Antisense; TGATGAAGGGCTATTCCCCGCAGGC
>probe:Drosophila_2:1626082_at:268:721; Interrogation_Position=775; Antisense; TTCCACCGATGTTGCAATCCTCAAG
>probe:Drosophila_2:1626082_at:125:379; Interrogation_Position=823; Antisense; GAAGCTGACGCTGTTAGTGTCTAAG
>probe:Drosophila_2:1626082_at:576:213; Interrogation_Position=845; Antisense; AAGAGACTGGACAACTTCGAGGCCC
>probe:Drosophila_2:1626082_at:403:149; Interrogation_Position=858; Antisense; ACTTCGAGGCCCAGCAGACGGAAAA

Paste this into a BLAST search page for me
TGATTTGCAGCGCTCCCAAGGTGGATGGAGCTGTTCATTGGACCCTTGCAGGAGTACTGCGAGACCATCTACGGCTACGGCACTTGCGTCGACGATGAGGCGACCCTATCGCTATGACATGGAAATAAACCTGAAGATGCTCACCTCGGCGAGATCTGCGTTTACGGAGCCCTGCCCAGGCCAATGGATGCGCAGCGAATAAGTTCGAGCAGTTCATGAGCCTGATGATGAAGGGCTATTCCCCGCAGGCTTCCACCGATGTTGCAATCCTCAAGGAAGCTGACGCTGTTAGTGTCTAAGAAGAGACTGGACAACTTCGAGGCCCACTTCGAGGCCCAGCAGACGGAAAA

Full Affymetrix probeset data:

Annotations for 1626082_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720