FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626083_at:

>probe:Drosophila_2:1626083_at:20:237; Interrogation_Position=104; Antisense; AATCGACGAAATCAGGCCACGCACA
>probe:Drosophila_2:1626083_at:552:395; Interrogation_Position=111; Antisense; GAAATCAGGCCACGCACACGAATCC
>probe:Drosophila_2:1626083_at:672:155; Interrogation_Position=126; Antisense; ACACGAATCCCGACACGGTGGCGGT
>probe:Drosophila_2:1626083_at:654:67; Interrogation_Position=173; Antisense; ATGGCGATGTAGATGACGTAGCGTT
>probe:Drosophila_2:1626083_at:542:97; Interrogation_Position=183; Antisense; AGATGACGTAGCGTTGCGATGCGAT
>probe:Drosophila_2:1626083_at:379:317; Interrogation_Position=222; Antisense; GCCTGCCACAGCCTACTACAGAAGG
>probe:Drosophila_2:1626083_at:227:667; Interrogation_Position=235; Antisense; TACTACAGAAGGCTGGCTTTCCCAG
>probe:Drosophila_2:1626083_at:281:569; Interrogation_Position=249; Antisense; GGCTTTCCCAGACCCGGAGACATTG
>probe:Drosophila_2:1626083_at:583:551; Interrogation_Position=264; Antisense; GGAGACATTGCCACTCCCACTCGTA
>probe:Drosophila_2:1626083_at:555:385; Interrogation_Position=294; Antisense; GAACATATCCCAAACCCAGAAGCAG
>probe:Drosophila_2:1626083_at:500:181; Interrogation_Position=59; Antisense; AAAACAAAGATGCTGCGCTCCTGAC
>probe:Drosophila_2:1626083_at:109:99; Interrogation_Position=66; Antisense; AGATGCTGCGCTCCTGACACTGAAA
>probe:Drosophila_2:1626083_at:198:629; Interrogation_Position=77; Antisense; TCCTGACACTGAAACCCGCACAAGG
>probe:Drosophila_2:1626083_at:679:297; Interrogation_Position=91; Antisense; CCCGCACAAGGCCAATCGACGAAAT

Paste this into a BLAST search page for me
AATCGACGAAATCAGGCCACGCACAGAAATCAGGCCACGCACACGAATCCACACGAATCCCGACACGGTGGCGGTATGGCGATGTAGATGACGTAGCGTTAGATGACGTAGCGTTGCGATGCGATGCCTGCCACAGCCTACTACAGAAGGTACTACAGAAGGCTGGCTTTCCCAGGGCTTTCCCAGACCCGGAGACATTGGGAGACATTGCCACTCCCACTCGTAGAACATATCCCAAACCCAGAAGCAGAAAACAAAGATGCTGCGCTCCTGACAGATGCTGCGCTCCTGACACTGAAATCCTGACACTGAAACCCGCACAAGGCCCGCACAAGGCCAATCGACGAAAT

Full Affymetrix probeset data:

Annotations for 1626083_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720