FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626086_at:

>probe:Drosophila_2:1626086_at:448:145; Interrogation_Position=1044; Antisense; ACTACGTTCCGGAGTGGGCGCAACT
>probe:Drosophila_2:1626086_at:28:71; Interrogation_Position=1131; Antisense; AGGCCATTCGCGACTGGAACAAACT
>probe:Drosophila_2:1626086_at:481:527; Interrogation_Position=1190; Antisense; GGGATCTCAGTACCTTCGAAAAGAA
>probe:Drosophila_2:1626086_at:413:447; Interrogation_Position=721; Antisense; GATGCTGTGCGATGATTATCCGGAT
>probe:Drosophila_2:1626086_at:602:61; Interrogation_Position=744; Antisense; ATGTGAAGTTCTGGGTGGCCTTCCA
>probe:Drosophila_2:1626086_at:347:57; Interrogation_Position=777; Antisense; ATGAGAATACCCTGGCGCATGGAGA
>probe:Drosophila_2:1626086_at:25:67; Interrogation_Position=795; Antisense; ATGGAGAAACCTTTGCGGACGCGGC
>probe:Drosophila_2:1626086_at:608:131; Interrogation_Position=813; Antisense; ACGCGGCGAATGCTATTTGGGACCT
>probe:Drosophila_2:1626086_at:651:691; Interrogation_Position=828; Antisense; TTTGGGACCTCTTGGCTGAACGAAA
>probe:Drosophila_2:1626086_at:312:657; Interrogation_Position=862; Antisense; TAAGTGCCTGGCCATCGGAGTAAAT
>probe:Drosophila_2:1626086_at:698:515; Interrogation_Position=888; Antisense; GTGTGCATCCGAAGTTTGTGACCCC
>probe:Drosophila_2:1626086_at:145:725; Interrogation_Position=903; Antisense; TTGTGACCCCGCTCTTTAAGAGTTT
>probe:Drosophila_2:1626086_at:308:265; Interrogation_Position=953; Antisense; CAGATACCGTTGGTGGTGTACCCCA
>probe:Drosophila_2:1626086_at:327:685; Interrogation_Position=990; Antisense; TATACGACGTGGTCAACGGCTGGCA

Paste this into a BLAST search page for me
ACTACGTTCCGGAGTGGGCGCAACTAGGCCATTCGCGACTGGAACAAACTGGGATCTCAGTACCTTCGAAAAGAAGATGCTGTGCGATGATTATCCGGATATGTGAAGTTCTGGGTGGCCTTCCAATGAGAATACCCTGGCGCATGGAGAATGGAGAAACCTTTGCGGACGCGGCACGCGGCGAATGCTATTTGGGACCTTTTGGGACCTCTTGGCTGAACGAAATAAGTGCCTGGCCATCGGAGTAAATGTGTGCATCCGAAGTTTGTGACCCCTTGTGACCCCGCTCTTTAAGAGTTTCAGATACCGTTGGTGGTGTACCCCATATACGACGTGGTCAACGGCTGGCA

Full Affymetrix probeset data:

Annotations for 1626086_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720