Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626087_at:

>probe:Drosophila_2:1626087_at:383:597; Interrogation_Position=12063; Antisense; TGTGCCTCGAGCTTTTTATGCCAAA
>probe:Drosophila_2:1626087_at:70:617; Interrogation_Position=12139; Antisense; TGCAATTCATTTGCCTAGCATCCGC
>probe:Drosophila_2:1626087_at:592:675; Interrogation_Position=12154; Antisense; TAGCATCCGCACATGTTGCCATTTA
>probe:Drosophila_2:1626087_at:85:675; Interrogation_Position=12202; Antisense; TAGCATCTACTATCCGTATGAACGT
>probe:Drosophila_2:1626087_at:45:559; Interrogation_Position=12279; Antisense; GGACAGTTCCCGTATTTATGCGAAA
>probe:Drosophila_2:1626087_at:334:687; Interrogation_Position=12304; Antisense; TATAGAATCCACATGCGCAGCATTG
>probe:Drosophila_2:1626087_at:713:401; Interrogation_Position=12328; Antisense; GACATATCCTGCAAAGTATACTCGA
>probe:Drosophila_2:1626087_at:92:33; Interrogation_Position=12368; Antisense; ATAATATCCGAGTCCTGGCCAAAGG
>probe:Drosophila_2:1626087_at:103:579; Interrogation_Position=12384; Antisense; GGCCAAAGGAAGCTCGACCAACAGT
>probe:Drosophila_2:1626087_at:367:481; Interrogation_Position=12407; Antisense; GTTTGATCCCCGACTCAGCAATAGC
>probe:Drosophila_2:1626087_at:685:647; Interrogation_Position=12435; Antisense; TCATGCCCCTCAGAACTATGTACAA
>probe:Drosophila_2:1626087_at:260:489; Interrogation_Position=12481; Antisense; GTACTTACTGTACTCGAACTCCACT
>probe:Drosophila_2:1626087_at:73:519; Interrogation_Position=12521; Antisense; GTGGCACCTACGTAAGCTATGGATT
>probe:Drosophila_2:1626087_at:43:541; Interrogation_Position=12541; Antisense; GGATTGCGCTTGAATGTGGCACACA

Paste this into a BLAST search page for me
TGTGCCTCGAGCTTTTTATGCCAAATGCAATTCATTTGCCTAGCATCCGCTAGCATCCGCACATGTTGCCATTTATAGCATCTACTATCCGTATGAACGTGGACAGTTCCCGTATTTATGCGAAATATAGAATCCACATGCGCAGCATTGGACATATCCTGCAAAGTATACTCGAATAATATCCGAGTCCTGGCCAAAGGGGCCAAAGGAAGCTCGACCAACAGTGTTTGATCCCCGACTCAGCAATAGCTCATGCCCCTCAGAACTATGTACAAGTACTTACTGTACTCGAACTCCACTGTGGCACCTACGTAAGCTATGGATTGGATTGCGCTTGAATGTGGCACACA

Full Affymetrix probeset data:

Annotations for 1626087_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime