Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626088_at:

>probe:Drosophila_2:1626088_at:100:25; Interrogation_Position=2261; Antisense; ATATGTATGTCACTGTGGTCGGCAG
>probe:Drosophila_2:1626088_at:108:591; Interrogation_Position=2276; Antisense; TGGTCGGCAGTCCTATTCGTGTCAA
>probe:Drosophila_2:1626088_at:433:503; Interrogation_Position=2285; Antisense; GTCCTATTCGTGTCAATGGTCACCA
>probe:Drosophila_2:1626088_at:400:429; Interrogation_Position=2312; Antisense; GAGTTTCTATACTACAATTTTGAGC
>probe:Drosophila_2:1626088_at:681:9; Interrogation_Position=2387; Antisense; ATTTGTGGTCCGGTGGGTATGCCCA
>probe:Drosophila_2:1626088_at:150:531; Interrogation_Position=2401; Antisense; GGGTATGCCCATGTTTATAAAGTTA
>probe:Drosophila_2:1626088_at:577:653; Interrogation_Position=2424; Antisense; TAATTCGACCCAGTCTAAAGTTCTG
>probe:Drosophila_2:1626088_at:240:481; Interrogation_Position=2468; Antisense; GTATTAACGAGTGCTTCTCTTTCCA
>probe:Drosophila_2:1626088_at:246:643; Interrogation_Position=2483; Antisense; TCTCTTTCCACTTACCTGCGTTCTA
>probe:Drosophila_2:1626088_at:647:281; Interrogation_Position=2498; Antisense; CTGCGTTCTACCAAATCTACCAATA
>probe:Drosophila_2:1626088_at:231:277; Interrogation_Position=2514; Antisense; CTACCAATAATTCTTGTGTCTTTGA
>probe:Drosophila_2:1626088_at:492:513; Interrogation_Position=2529; Antisense; GTGTCTTTGAATCTACATTGAGTCA
>probe:Drosophila_2:1626088_at:201:527; Interrogation_Position=2587; Antisense; GGGACCATAGCCATACATGAAACTA
>probe:Drosophila_2:1626088_at:353:143; Interrogation_Position=2781; Antisense; ACTGGAGAACATTTATTCCTGTAAA

Paste this into a BLAST search page for me
ATATGTATGTCACTGTGGTCGGCAGTGGTCGGCAGTCCTATTCGTGTCAAGTCCTATTCGTGTCAATGGTCACCAGAGTTTCTATACTACAATTTTGAGCATTTGTGGTCCGGTGGGTATGCCCAGGGTATGCCCATGTTTATAAAGTTATAATTCGACCCAGTCTAAAGTTCTGGTATTAACGAGTGCTTCTCTTTCCATCTCTTTCCACTTACCTGCGTTCTACTGCGTTCTACCAAATCTACCAATACTACCAATAATTCTTGTGTCTTTGAGTGTCTTTGAATCTACATTGAGTCAGGGACCATAGCCATACATGAAACTAACTGGAGAACATTTATTCCTGTAAA

Full Affymetrix probeset data:

Annotations for 1626088_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime