Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626090_at:

>probe:Drosophila_2:1626090_at:671:433; Interrogation_Position=4815; Antisense; GAGGACGCATACCTAGTTTTCTAGA
>probe:Drosophila_2:1626090_at:572:245; Interrogation_Position=4863; Antisense; AATTCTTCAGATTCGATTTGTAGCG
>probe:Drosophila_2:1626090_at:234:671; Interrogation_Position=4883; Antisense; TAGCGATGCAGAGAATACGTTTATT
>probe:Drosophila_2:1626090_at:695:475; Interrogation_Position=4901; Antisense; GTTTATTTTTGTACGCTTGAACAGA
>probe:Drosophila_2:1626090_at:401:723; Interrogation_Position=4917; Antisense; TTGAACAGAGGAACCGGCGGAGATC
>probe:Drosophila_2:1626090_at:464:365; Interrogation_Position=4959; Antisense; GAATAGCTTTTAGACAACTCGACTT
>probe:Drosophila_2:1626090_at:467:189; Interrogation_Position=4974; Antisense; AACTCGACTTTTACAGTATAGCTCT
>probe:Drosophila_2:1626090_at:582:387; Interrogation_Position=5081; Antisense; GAAAATGAAGCGACCGCCCGCATAT
>probe:Drosophila_2:1626090_at:125:287; Interrogation_Position=5148; Antisense; CTGGGAACTCCAAAATCACGCTCTT
>probe:Drosophila_2:1626090_at:202:135; Interrogation_Position=5165; Antisense; ACGCTCTTCAAACCCACAAAAATGC
>probe:Drosophila_2:1626090_at:232:277; Interrogation_Position=5226; Antisense; CTAAAATTATACAGTGCGTTTCGGG
>probe:Drosophila_2:1626090_at:147:119; Interrogation_Position=5330; Antisense; AGCGAGTACAGCTCTAAAACGCACT
>probe:Drosophila_2:1626090_at:83:183; Interrogation_Position=5345; Antisense; AAAACGCACTGTATTCACCACGAGC
>probe:Drosophila_2:1626090_at:480:601; Interrogation_Position=5354; Antisense; TGTATTCACCACGAGCATTCAAAAT

Paste this into a BLAST search page for me
GAGGACGCATACCTAGTTTTCTAGAAATTCTTCAGATTCGATTTGTAGCGTAGCGATGCAGAGAATACGTTTATTGTTTATTTTTGTACGCTTGAACAGATTGAACAGAGGAACCGGCGGAGATCGAATAGCTTTTAGACAACTCGACTTAACTCGACTTTTACAGTATAGCTCTGAAAATGAAGCGACCGCCCGCATATCTGGGAACTCCAAAATCACGCTCTTACGCTCTTCAAACCCACAAAAATGCCTAAAATTATACAGTGCGTTTCGGGAGCGAGTACAGCTCTAAAACGCACTAAAACGCACTGTATTCACCACGAGCTGTATTCACCACGAGCATTCAAAAT

Full Affymetrix probeset data:

Annotations for 1626090_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime