FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626093_at:

>probe:Drosophila_2:1626093_at:69:611; Interrogation_Position=287; Antisense; TGACCATTTACTACGGAGCCACCGT
>probe:Drosophila_2:1626093_at:702:695; Interrogation_Position=341; Antisense; TTTCCGCCGATAACTTCGTTCAGCA
>probe:Drosophila_2:1626093_at:4:135; Interrogation_Position=365; Antisense; ACGCCAGCTACAACTCGATTGTGTT
>probe:Drosophila_2:1626093_at:195:603; Interrogation_Position=407; Antisense; TGATCAAGACCCCAACGGTTGCCTT
>probe:Drosophila_2:1626093_at:611:665; Interrogation_Position=487; Antisense; TACACTGGACAGCAGGCTATTGCCT
>probe:Drosophila_2:1626093_at:168:187; Interrogation_Position=553; Antisense; AACACTCTGCAGTACGAAGTCTTCG
>probe:Drosophila_2:1626093_at:272:373; Interrogation_Position=568; Antisense; GAAGTCTTCGAGGTTGTGTCCGTCT
>probe:Drosophila_2:1626093_at:471:729; Interrogation_Position=581; Antisense; TTGTGTCCGTCTCTCAATGCCAGAA
>probe:Drosophila_2:1626093_at:345:385; Interrogation_Position=603; Antisense; GAACACTTATGGCTCTCTGGTAGCC
>probe:Drosophila_2:1626093_at:632:589; Interrogation_Position=620; Antisense; TGGTAGCCACCAACAACGTGATCTG
>probe:Drosophila_2:1626093_at:365:591; Interrogation_Position=698; Antisense; TGGTCCTGGTCAGCGACAGTAAGCT
>probe:Drosophila_2:1626093_at:143:153; Interrogation_Position=713; Antisense; ACAGTAAGCTCATCGGTGTCACCTC
>probe:Drosophila_2:1626093_at:425:307; Interrogation_Position=737; Antisense; CCTTCGTGTCGAGCGCTGGTTGTGA
>probe:Drosophila_2:1626093_at:408:575; Interrogation_Position=826; Antisense; GGCGTCTCCTACTAAGCACAGCATA

Paste this into a BLAST search page for me
TGACCATTTACTACGGAGCCACCGTTTTCCGCCGATAACTTCGTTCAGCAACGCCAGCTACAACTCGATTGTGTTTGATCAAGACCCCAACGGTTGCCTTTACACTGGACAGCAGGCTATTGCCTAACACTCTGCAGTACGAAGTCTTCGGAAGTCTTCGAGGTTGTGTCCGTCTTTGTGTCCGTCTCTCAATGCCAGAAGAACACTTATGGCTCTCTGGTAGCCTGGTAGCCACCAACAACGTGATCTGTGGTCCTGGTCAGCGACAGTAAGCTACAGTAAGCTCATCGGTGTCACCTCCCTTCGTGTCGAGCGCTGGTTGTGAGGCGTCTCCTACTAAGCACAGCATA

Full Affymetrix probeset data:

Annotations for 1626093_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720