FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626094_at:

>probe:Drosophila_2:1626094_at:596:633; Interrogation_Position=1042; Antisense; TCCCATCGACGTGGTTCAGAGCGAT
>probe:Drosophila_2:1626094_at:656:649; Interrogation_Position=1066; Antisense; TCAACCAGACGCAGCCTATGTGGAT
>probe:Drosophila_2:1626094_at:548:443; Interrogation_Position=1126; Antisense; GATGTTCGCCAAGTACAAGGATCAG
>probe:Drosophila_2:1626094_at:33:545; Interrogation_Position=1144; Antisense; GGATCAGTACATACCGAACTCCAAG
>probe:Drosophila_2:1626094_at:437:251; Interrogation_Position=1174; Antisense; CAAGCTGATTATACACTAGTCGAGA
>probe:Drosophila_2:1626094_at:676:395; Interrogation_Position=695; Antisense; GACAATCGTGATGGGTTCACCTCCA
>probe:Drosophila_2:1626094_at:120:281; Interrogation_Position=715; Antisense; CTCCAACGCGGTGGCTATTCTGGTG
>probe:Drosophila_2:1626094_at:168:677; Interrogation_Position=759; Antisense; TAGACTCGCACCCTGGCAAATATAT
>probe:Drosophila_2:1626094_at:194:73; Interrogation_Position=827; Antisense; AGGACAGGGTCTTCGATTGTTCCCA
>probe:Drosophila_2:1626094_at:504:631; Interrogation_Position=847; Antisense; TCCCACGTTTTCCTTTGGCGAGGTG
>probe:Drosophila_2:1626094_at:70:559; Interrogation_Position=871; Antisense; GGACATTCTGGATCAGGTTGCCAAT
>probe:Drosophila_2:1626094_at:585:289; Interrogation_Position=907; Antisense; TCGGGTTCGTCGCTTTCAAGACTTT
>probe:Drosophila_2:1626094_at:640:541; Interrogation_Position=948; Antisense; GGATATCTCCGCTGATTCCCGTTGG
>probe:Drosophila_2:1626094_at:257:17; Interrogation_Position=980; Antisense; ATCTTCAACTACTCCTTTGGCTTTC

Paste this into a BLAST search page for me
TCCCATCGACGTGGTTCAGAGCGATTCAACCAGACGCAGCCTATGTGGATGATGTTCGCCAAGTACAAGGATCAGGGATCAGTACATACCGAACTCCAAGCAAGCTGATTATACACTAGTCGAGAGACAATCGTGATGGGTTCACCTCCACTCCAACGCGGTGGCTATTCTGGTGTAGACTCGCACCCTGGCAAATATATAGGACAGGGTCTTCGATTGTTCCCATCCCACGTTTTCCTTTGGCGAGGTGGGACATTCTGGATCAGGTTGCCAATTCGGGTTCGTCGCTTTCAAGACTTTGGATATCTCCGCTGATTCCCGTTGGATCTTCAACTACTCCTTTGGCTTTC

Full Affymetrix probeset data:

Annotations for 1626094_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720