FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626095_at:

>probe:Drosophila_2:1626095_at:287:1; Interrogation_Position=828; Antisense; AGCCCCTCTAAGTGGTAATAAGTTG
>probe:Drosophila_2:1626095_at:463:491; Interrogation_Position=842; Antisense; GTAATAAGTTGTGCAATTCCCACGT
>probe:Drosophila_2:1626095_at:662:31; Interrogation_Position=845; Antisense; ATAAGTTGTGCAATTCCCACGTTGC
>probe:Drosophila_2:1626095_at:136:217; Interrogation_Position=847; Antisense; AAGTTGTGCAATTCCCACGTTGCAG
>probe:Drosophila_2:1626095_at:398:727; Interrogation_Position=850; Antisense; TTGTGCAATTCCCACGTTGCAGCAC
>probe:Drosophila_2:1626095_at:294:363; Interrogation_Position=854; Antisense; GCAATTCCCACGTTGCAGCACCAAT
>probe:Drosophila_2:1626095_at:649:717; Interrogation_Position=858; Antisense; TTCCCACGTTGCAGCACCAATCTAA
>probe:Drosophila_2:1626095_at:51:261; Interrogation_Position=862; Antisense; CACGTTGCAGCACCAATCTAATAAT
>probe:Drosophila_2:1626095_at:136:469; Interrogation_Position=865; Antisense; GTTGCAGCACCAATCTAATAATCGT
>probe:Drosophila_2:1626095_at:125:127; Interrogation_Position=873; Antisense; ACCAATCTAATAATCGTGTTCTCTT
>probe:Drosophila_2:1626095_at:362:237; Interrogation_Position=884; Antisense; AATCGTGTTCTCTTAGTTATCCCAA
>probe:Drosophila_2:1626095_at:309:637; Interrogation_Position=886; Antisense; TCGTGTTCTCTTAGTTATCCCAATG
>probe:Drosophila_2:1626095_at:583:291; Interrogation_Position=887; Antisense; CGTGTTCTCTTAGTTATCCCAATGA
>probe:Drosophila_2:1626095_at:217:603; Interrogation_Position=889; Antisense; TGTTCTCTTAGTTATCCCAATGAAA

Paste this into a BLAST search page for me
AGCCCCTCTAAGTGGTAATAAGTTGGTAATAAGTTGTGCAATTCCCACGTATAAGTTGTGCAATTCCCACGTTGCAAGTTGTGCAATTCCCACGTTGCAGTTGTGCAATTCCCACGTTGCAGCACGCAATTCCCACGTTGCAGCACCAATTTCCCACGTTGCAGCACCAATCTAACACGTTGCAGCACCAATCTAATAATGTTGCAGCACCAATCTAATAATCGTACCAATCTAATAATCGTGTTCTCTTAATCGTGTTCTCTTAGTTATCCCAATCGTGTTCTCTTAGTTATCCCAATGCGTGTTCTCTTAGTTATCCCAATGATGTTCTCTTAGTTATCCCAATGAAA

Full Affymetrix probeset data:

Annotations for 1626095_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720