FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626096_at:

>probe:Drosophila_2:1626096_at:181:411; Interrogation_Position=1013; Antisense; GACGCATCTTATCCCCTGGAATTTA
>probe:Drosophila_2:1626096_at:37:491; Interrogation_Position=586; Antisense; GTACATGCAGCACCAGTTACTTGTG
>probe:Drosophila_2:1626096_at:605:591; Interrogation_Position=634; Antisense; TGTGCTGGAAACTGGCGGAACTTTT
>probe:Drosophila_2:1626096_at:115:395; Interrogation_Position=678; Antisense; GAAATGCCACATCGCTATTGAGCTC
>probe:Drosophila_2:1626096_at:703:725; Interrogation_Position=695; Antisense; TTGAGCTCCCAGATGCAGATATTTT
>probe:Drosophila_2:1626096_at:374:247; Interrogation_Position=726; Antisense; AATTCGACATCTACAAGCCACCGAG
>probe:Drosophila_2:1626096_at:556:427; Interrogation_Position=748; Antisense; GAGTTCGCGTCCTTCGAGCATTGAA
>probe:Drosophila_2:1626096_at:589:377; Interrogation_Position=770; Antisense; GAAGCTTTTGTGGTTTGCTCCGATT
>probe:Drosophila_2:1626096_at:440:459; Interrogation_Position=791; Antisense; GATTTTTGCCTTCCCGAGGGCTACA
>probe:Drosophila_2:1626096_at:102:525; Interrogation_Position=808; Antisense; GGGCTACATTCCTCAAGTGATTAAC
>probe:Drosophila_2:1626096_at:17:463; Interrogation_Position=826; Antisense; GATTAACCCTGCTCGCGATGATATA
>probe:Drosophila_2:1626096_at:730:443; Interrogation_Position=842; Antisense; GATGATATACGGCTACTGGCACAGA
>probe:Drosophila_2:1626096_at:219:501; Interrogation_Position=888; Antisense; GTCGTCTAGTTCCTTTTATAGCCTG
>probe:Drosophila_2:1626096_at:703:401; Interrogation_Position=952; Antisense; GACTTCCTCCTCAGATGAATCCAAA

Paste this into a BLAST search page for me
GACGCATCTTATCCCCTGGAATTTAGTACATGCAGCACCAGTTACTTGTGTGTGCTGGAAACTGGCGGAACTTTTGAAATGCCACATCGCTATTGAGCTCTTGAGCTCCCAGATGCAGATATTTTAATTCGACATCTACAAGCCACCGAGGAGTTCGCGTCCTTCGAGCATTGAAGAAGCTTTTGTGGTTTGCTCCGATTGATTTTTGCCTTCCCGAGGGCTACAGGGCTACATTCCTCAAGTGATTAACGATTAACCCTGCTCGCGATGATATAGATGATATACGGCTACTGGCACAGAGTCGTCTAGTTCCTTTTATAGCCTGGACTTCCTCCTCAGATGAATCCAAA

Full Affymetrix probeset data:

Annotations for 1626096_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720