Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626098_at:

>probe:Drosophila_2:1626098_at:625:569; Interrogation_Position=1266; Antisense; GGCTACTACGCCAATCCGAATGAAT
>probe:Drosophila_2:1626098_at:119:347; Interrogation_Position=1297; Antisense; GCATGCAGGACTACCAGGGCTGGTT
>probe:Drosophila_2:1626098_at:333:385; Interrogation_Position=1355; Antisense; GAACTACCTGCATATCGTGGAGCGA
>probe:Drosophila_2:1626098_at:31:171; Interrogation_Position=1379; Antisense; AAAGGAGGATCTTCTGCGCTTCCAT
>probe:Drosophila_2:1626098_at:142:107; Interrogation_Position=1424; Antisense; AGAAATTGAGCAGGTCATCGCCGAG
>probe:Drosophila_2:1626098_at:386:623; Interrogation_Position=1450; Antisense; TGCCGGACGTGATCGAAGCCTGTGT
>probe:Drosophila_2:1626098_at:373:205; Interrogation_Position=1465; Antisense; AAGCCTGTGTCTTTGGCCTGTGGAA
>probe:Drosophila_2:1626098_at:253:331; Interrogation_Position=1515; Antisense; GCGGCTGTCGTCAAAATACCTGGCA
>probe:Drosophila_2:1626098_at:433:569; Interrogation_Position=1536; Antisense; GGCAGTCGTCTCACCGAAATGGATA
>probe:Drosophila_2:1626098_at:177:593; Interrogation_Position=1585; Antisense; TGGTGGTCGACCACAAGCAGCTTCA
>probe:Drosophila_2:1626098_at:494:199; Interrogation_Position=1649; Antisense; AAGCGGCAAGGTTCTACGTCAGCAG
>probe:Drosophila_2:1626098_at:602:71; Interrogation_Position=1672; Antisense; AGGCACGCGATCAGGCACTGGGTAA
>probe:Drosophila_2:1626098_at:415:359; Interrogation_Position=1714; Antisense; GCAACGGCCACTAATCTTTTCATAG
>probe:Drosophila_2:1626098_at:388:139; Interrogation_Position=1779; Antisense; ACGGGTGACTCATCCATTCAAGACA

Paste this into a BLAST search page for me
GGCTACTACGCCAATCCGAATGAATGCATGCAGGACTACCAGGGCTGGTTGAACTACCTGCATATCGTGGAGCGAAAAGGAGGATCTTCTGCGCTTCCATAGAAATTGAGCAGGTCATCGCCGAGTGCCGGACGTGATCGAAGCCTGTGTAAGCCTGTGTCTTTGGCCTGTGGAAGCGGCTGTCGTCAAAATACCTGGCAGGCAGTCGTCTCACCGAAATGGATATGGTGGTCGACCACAAGCAGCTTCAAAGCGGCAAGGTTCTACGTCAGCAGAGGCACGCGATCAGGCACTGGGTAAGCAACGGCCACTAATCTTTTCATAGACGGGTGACTCATCCATTCAAGACA

Full Affymetrix probeset data:

Annotations for 1626098_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime