FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626100_at:

>probe:Drosophila_2:1626100_at:174:569; Interrogation_Position=105; Antisense; GGCAGCTTCTGGAATCGCAGTACTT
>probe:Drosophila_2:1626100_at:626:489; Interrogation_Position=124; Antisense; GTACTTGTGGTTTTGCTATCTGGCT
>probe:Drosophila_2:1626100_at:497:313; Interrogation_Position=149; Antisense; GCCTTTTTGCTACCCAGATGGTCAA
>probe:Drosophila_2:1626100_at:514:65; Interrogation_Position=166; Antisense; ATGGTCAACCACTACACGTTGCTTA
>probe:Drosophila_2:1626100_at:31:163; Interrogation_Position=229; Antisense; AAATTGTATCTAGCCACTCACACTC
>probe:Drosophila_2:1626100_at:148:715; Interrogation_Position=277; Antisense; TTCTTATTTGGCTACTTTCTGCATA
>probe:Drosophila_2:1626100_at:90:721; Interrogation_Position=319; Antisense; TTCCAGCTAAGCAGGCCTATTGTGT
>probe:Drosophila_2:1626100_at:174:281; Interrogation_Position=358; Antisense; CTCAGCTTGGCGATGCTTTTTACAT
>probe:Drosophila_2:1626100_at:286:637; Interrogation_Position=382; Antisense; TCGATTTTTGCTCTATATCCGGCTT
>probe:Drosophila_2:1626100_at:216:589; Interrogation_Position=437; Antisense; TGGAGGAATCCCTATACTACACCCT
>probe:Drosophila_2:1626100_at:643:581; Interrogation_Position=475; Antisense; TGGCCCTTGGCCATTTGTTGGATAA
>probe:Drosophila_2:1626100_at:46:467; Interrogation_Position=491; Antisense; GTTGGATAATTTTTGCCTGCATGCA
>probe:Drosophila_2:1626100_at:557:265; Interrogation_Position=514; Antisense; CAGGGCTACGGTGGTTTGGCCAATA
>probe:Drosophila_2:1626100_at:2:265; Interrogation_Position=573; Antisense; CAGACTTTCCTACTCCATGTATATT

Paste this into a BLAST search page for me
GGCAGCTTCTGGAATCGCAGTACTTGTACTTGTGGTTTTGCTATCTGGCTGCCTTTTTGCTACCCAGATGGTCAAATGGTCAACCACTACACGTTGCTTAAAATTGTATCTAGCCACTCACACTCTTCTTATTTGGCTACTTTCTGCATATTCCAGCTAAGCAGGCCTATTGTGTCTCAGCTTGGCGATGCTTTTTACATTCGATTTTTGCTCTATATCCGGCTTTGGAGGAATCCCTATACTACACCCTTGGCCCTTGGCCATTTGTTGGATAAGTTGGATAATTTTTGCCTGCATGCACAGGGCTACGGTGGTTTGGCCAATACAGACTTTCCTACTCCATGTATATT

Full Affymetrix probeset data:

Annotations for 1626100_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720