FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626101_at:

>probe:Drosophila_2:1626101_at:527:75; Interrogation_Position=415; Antisense; AGGAGCTGCAGGTAACCCACTTGGC
>probe:Drosophila_2:1626101_at:536:347; Interrogation_Position=422; Antisense; GCAGGTAACCCACTTGGCCGGTCGT
>probe:Drosophila_2:1626101_at:131:467; Interrogation_Position=435; Antisense; TTGGCCGGTCGTCTCGCGTTACCGC
>probe:Drosophila_2:1626101_at:599:257; Interrogation_Position=463; Antisense; CACAACAGTGAGCACTCTGCGGTGT
>probe:Drosophila_2:1626101_at:621:145; Interrogation_Position=476; Antisense; ACTCTGCGGTGTGCTGTGCCGGCAT
>probe:Drosophila_2:1626101_at:171:627; Interrogation_Position=492; Antisense; TGCCGGCATGGCCACATCCGCAATA
>probe:Drosophila_2:1626101_at:720:43; Interrogation_Position=507; Antisense; ATCCGCAATACTCCAAAAACCGCAT
>probe:Drosophila_2:1626101_at:540:181; Interrogation_Position=522; Antisense; AAAACCGCATATGTACATCCAAATA
>probe:Drosophila_2:1626101_at:6:491; Interrogation_Position=534; Antisense; GTACATCCAAATACTCGGAAACAAT
>probe:Drosophila_2:1626101_at:161:561; Interrogation_Position=550; Antisense; GGAAACAATCGAAATGGACCACACC
>probe:Drosophila_2:1626101_at:586:393; Interrogation_Position=560; Antisense; GAAATGGACCACACCACACAGTTAC
>probe:Drosophila_2:1626101_at:49:129; Interrogation_Position=567; Antisense; ACCACACCACACAGTTACACTAAAA
>probe:Drosophila_2:1626101_at:275:215; Interrogation_Position=590; Antisense; AAGTTTGCCCTAAAAGTCTGTACAG
>probe:Drosophila_2:1626101_at:34:501; Interrogation_Position=605; Antisense; GTCTGTACAGTAATCACTTTGCTAG

Paste this into a BLAST search page for me
AGGAGCTGCAGGTAACCCACTTGGCGCAGGTAACCCACTTGGCCGGTCGTTTGGCCGGTCGTCTCGCGTTACCGCCACAACAGTGAGCACTCTGCGGTGTACTCTGCGGTGTGCTGTGCCGGCATTGCCGGCATGGCCACATCCGCAATAATCCGCAATACTCCAAAAACCGCATAAAACCGCATATGTACATCCAAATAGTACATCCAAATACTCGGAAACAATGGAAACAATCGAAATGGACCACACCGAAATGGACCACACCACACAGTTACACCACACCACACAGTTACACTAAAAAAGTTTGCCCTAAAAGTCTGTACAGGTCTGTACAGTAATCACTTTGCTAG

Full Affymetrix probeset data:

Annotations for 1626101_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720