FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626103_at:

>probe:Drosophila_2:1626103_at:679:647; Interrogation_Position=341; Antisense; TCACCTACCCGCAGAACAAGGGCGA
>probe:Drosophila_2:1626103_at:618:221; Interrogation_Position=358; Antisense; AAGGGCGAGATCCTCATCCATCGTC
>probe:Drosophila_2:1626103_at:227:223; Interrogation_Position=415; Antisense; AAGGTGCTGGTGAACCATCCACCAT
>probe:Drosophila_2:1626103_at:366:625; Interrogation_Position=432; Antisense; TCCACCATTGGTGGTTAAGCCCGCT
>probe:Drosophila_2:1626103_at:73:715; Interrogation_Position=488; Antisense; TTCTCCGCAAGGTCTACGTCAAGCA
>probe:Drosophila_2:1626103_at:2:503; Interrogation_Position=521; Antisense; GTCGCGTCAAGGTTGAGCCCGTGTT
>probe:Drosophila_2:1626103_at:594:123; Interrogation_Position=536; Antisense; AGCCCGTGTTCGTCAATGTGGTCAA
>probe:Drosophila_2:1626103_at:637:159; Interrogation_Position=593; Antisense; ACAAGCAGGGCTACGGACAGGGCTC
>probe:Drosophila_2:1626103_at:650:157; Interrogation_Position=630; Antisense; ACACGGCCATGGACACGGTGGCCAT
>probe:Drosophila_2:1626103_at:376:585; Interrogation_Position=684; Antisense; TGGACACGGTGCTGGACCCCATGGT
>probe:Drosophila_2:1626103_at:22:673; Interrogation_Position=745; Antisense; TACGCTTCGGGAGCTGATTCCGCTG
>probe:Drosophila_2:1626103_at:423:123; Interrogation_Position=775; Antisense; AGCGCTGGCTATCAGCTGCTCCAGA
>probe:Drosophila_2:1626103_at:82:205; Interrogation_Position=870; Antisense; AAGCCATCAGCACTATAGCGCCGGT
>probe:Drosophila_2:1626103_at:285:559; Interrogation_Position=901; Antisense; GGACATGGCGGCTATGCTGCTCCCG

Paste this into a BLAST search page for me
TCACCTACCCGCAGAACAAGGGCGAAAGGGCGAGATCCTCATCCATCGTCAAGGTGCTGGTGAACCATCCACCATTCCACCATTGGTGGTTAAGCCCGCTTTCTCCGCAAGGTCTACGTCAAGCAGTCGCGTCAAGGTTGAGCCCGTGTTAGCCCGTGTTCGTCAATGTGGTCAAACAAGCAGGGCTACGGACAGGGCTCACACGGCCATGGACACGGTGGCCATTGGACACGGTGCTGGACCCCATGGTTACGCTTCGGGAGCTGATTCCGCTGAGCGCTGGCTATCAGCTGCTCCAGAAAGCCATCAGCACTATAGCGCCGGTGGACATGGCGGCTATGCTGCTCCCG

Full Affymetrix probeset data:

Annotations for 1626103_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720