FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626108_at:

>probe:Drosophila_2:1626108_at:682:229; Interrogation_Position=1004; Antisense; AATGTTTCGCGTGAGCTGTCTTAAA
>probe:Drosophila_2:1626108_at:671:303; Interrogation_Position=431; Antisense; CCGTGCCTGGGTTGATCTCTTTGAG
>probe:Drosophila_2:1626108_at:700:451; Interrogation_Position=444; Antisense; GATCTCTTTGAGCTGTACACCACAG
>probe:Drosophila_2:1626108_at:10:129; Interrogation_Position=462; Antisense; ACCACAGAGGATCTGGAGCGCCGTA
>probe:Drosophila_2:1626108_at:724:415; Interrogation_Position=477; Antisense; GAGCGCCGTATGAAGTTTGCCTTTG
>probe:Drosophila_2:1626108_at:28:181; Interrogation_Position=519; Antisense; AACACCGGAGTTATCGATCGCGAGC
>probe:Drosophila_2:1626108_at:313:245; Interrogation_Position=565; Antisense; AATTCTTCCACGAAGGCGACGACGA
>probe:Drosophila_2:1626108_at:618:481; Interrogation_Position=663; Antisense; GTCATTTCGTTTGAGGACTACTCCT
>probe:Drosophila_2:1626108_at:78:75; Interrogation_Position=676; Antisense; AGGACTACTCCTCGGTTGTTTCACA
>probe:Drosophila_2:1626108_at:703:523; Interrogation_Position=725; Antisense; GGGCTGGCTATTTCCATCGAACGAA
>probe:Drosophila_2:1626108_at:271:223; Interrogation_Position=752; Antisense; AAGGGATCTTATGGCCCATGTTATC
>probe:Drosophila_2:1626108_at:522:65; Interrogation_Position=780; Antisense; ATGGACTCCATGCTCAATTATTGTA
>probe:Drosophila_2:1626108_at:363:461; Interrogation_Position=833; Antisense; GATTAAGCTTGATTATCCCACTGTG
>probe:Drosophila_2:1626108_at:252:547; Interrogation_Position=899; Antisense; GGATGCCGCCAAAGTAGTTGATCAA

Paste this into a BLAST search page for me
AATGTTTCGCGTGAGCTGTCTTAAACCGTGCCTGGGTTGATCTCTTTGAGGATCTCTTTGAGCTGTACACCACAGACCACAGAGGATCTGGAGCGCCGTAGAGCGCCGTATGAAGTTTGCCTTTGAACACCGGAGTTATCGATCGCGAGCAATTCTTCCACGAAGGCGACGACGAGTCATTTCGTTTGAGGACTACTCCTAGGACTACTCCTCGGTTGTTTCACAGGGCTGGCTATTTCCATCGAACGAAAAGGGATCTTATGGCCCATGTTATCATGGACTCCATGCTCAATTATTGTAGATTAAGCTTGATTATCCCACTGTGGGATGCCGCCAAAGTAGTTGATCAA

Full Affymetrix probeset data:

Annotations for 1626108_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720