Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626111_at:

>probe:Drosophila_2:1626111_at:243:117; Interrogation_Position=2685; Antisense; AGCTATTTGAGCTGGAGCCACTCTC
>probe:Drosophila_2:1626111_at:290:127; Interrogation_Position=2700; Antisense; AGCCACTCTCTGTTGAGTTCCTGGA
>probe:Drosophila_2:1626111_at:107:103; Interrogation_Position=2724; Antisense; AGAGCATAATCGCTAGCTTCACTCC
>probe:Drosophila_2:1626111_at:435:211; Interrogation_Position=2753; Antisense; AAGAACCTGTGGTACGGCTGCGCCA
>probe:Drosophila_2:1626111_at:214:323; Interrogation_Position=2772; Antisense; GCGCCAACTTTCTGAAGCTCGAGGA
>probe:Drosophila_2:1626111_at:577:115; Interrogation_Position=2787; Antisense; AGCTCGAGGACGCTACCTTGGGCAA
>probe:Drosophila_2:1626111_at:572:593; Interrogation_Position=2805; Antisense; TGGGCAACCCGATAGCGCAACTGGA
>probe:Drosophila_2:1626111_at:102:151; Interrogation_Position=2850; Antisense; ACTTGATGAGGCTTCGCGACGAACT
>probe:Drosophila_2:1626111_at:726:547; Interrogation_Position=2917; Antisense; GGATGTGGCCAAAACGTTCATTGCA
>probe:Drosophila_2:1626111_at:349:407; Interrogation_Position=2948; Antisense; GACGATTTCGTTCCAGTTTACAACA
>probe:Drosophila_2:1626111_at:318:383; Interrogation_Position=2995; Antisense; GAACTGGATGTACATTCACTGGCAA
>probe:Drosophila_2:1626111_at:402:385; Interrogation_Position=3067; Antisense; GAACTATCAGTACCTCATTCGTAAG
>probe:Drosophila_2:1626111_at:729:555; Interrogation_Position=3084; Antisense; TTCGTAAGGGCATCTTGGACGTCCT
>probe:Drosophila_2:1626111_at:403:679; Interrogation_Position=3211; Antisense; TATGTTGTTGCGCAAACAGCTCCGC

Paste this into a BLAST search page for me
AGCTATTTGAGCTGGAGCCACTCTCAGCCACTCTCTGTTGAGTTCCTGGAAGAGCATAATCGCTAGCTTCACTCCAAGAACCTGTGGTACGGCTGCGCCAGCGCCAACTTTCTGAAGCTCGAGGAAGCTCGAGGACGCTACCTTGGGCAATGGGCAACCCGATAGCGCAACTGGAACTTGATGAGGCTTCGCGACGAACTGGATGTGGCCAAAACGTTCATTGCAGACGATTTCGTTCCAGTTTACAACAGAACTGGATGTACATTCACTGGCAAGAACTATCAGTACCTCATTCGTAAGTTCGTAAGGGCATCTTGGACGTCCTTATGTTGTTGCGCAAACAGCTCCGC

Full Affymetrix probeset data:

Annotations for 1626111_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime