Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626112_at:

>probe:Drosophila_2:1626112_at:424:321; Interrogation_Position=3428; Antisense; GCGCCGGAAGTGTGCCCCATGGAAA
>probe:Drosophila_2:1626112_at:124:177; Interrogation_Position=3450; Antisense; AAACCGCCGCTTATGTGAGCAGTCA
>probe:Drosophila_2:1626112_at:562:495; Interrogation_Position=3471; Antisense; GTCACTCAAGCTGATCGCAACGTGT
>probe:Drosophila_2:1626112_at:52:391; Interrogation_Position=3515; Antisense; GAAACTGAAGCCAAGCGACCATCTC
>probe:Drosophila_2:1626112_at:618:255; Interrogation_Position=3539; Antisense; CACAACCTATGAATCTCGGACGCTA
>probe:Drosophila_2:1626112_at:521:555; Interrogation_Position=3556; Antisense; GGACGCTAATCCACTGCAATACAGG
>probe:Drosophila_2:1626112_at:338:231; Interrogation_Position=3593; Antisense; AATGTTCGACTTAAGCACTGACTGC
>probe:Drosophila_2:1626112_at:39:111; Interrogation_Position=3606; Antisense; AGCACTGACTGCACCGAAAGACGTA
>probe:Drosophila_2:1626112_at:386:17; Interrogation_Position=3658; Antisense; ATTTATTCAAGCTTCCACACGAGGG
>probe:Drosophila_2:1626112_at:691:245; Interrogation_Position=3689; Antisense; AATTCAATCCTATGACGCAGCGGTG
>probe:Drosophila_2:1626112_at:235:411; Interrogation_Position=3702; Antisense; GACGCAGCGGTGTATTTTTCGCACC
>probe:Drosophila_2:1626112_at:114:701; Interrogation_Position=3774; Antisense; TTTTTGTGATATCCATCCAGTCCCA
>probe:Drosophila_2:1626112_at:383:61; Interrogation_Position=3812; Antisense; ATGTCTGTACTCGATATCCCCAATG
>probe:Drosophila_2:1626112_at:685:235; Interrogation_Position=3977; Antisense; AATCGACTTTTACGTGCTATTCTAA

Paste this into a BLAST search page for me
GCGCCGGAAGTGTGCCCCATGGAAAAAACCGCCGCTTATGTGAGCAGTCAGTCACTCAAGCTGATCGCAACGTGTGAAACTGAAGCCAAGCGACCATCTCCACAACCTATGAATCTCGGACGCTAGGACGCTAATCCACTGCAATACAGGAATGTTCGACTTAAGCACTGACTGCAGCACTGACTGCACCGAAAGACGTAATTTATTCAAGCTTCCACACGAGGGAATTCAATCCTATGACGCAGCGGTGGACGCAGCGGTGTATTTTTCGCACCTTTTTGTGATATCCATCCAGTCCCAATGTCTGTACTCGATATCCCCAATGAATCGACTTTTACGTGCTATTCTAA

Full Affymetrix probeset data:

Annotations for 1626112_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime