Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626113_at:

>probe:Drosophila_2:1626113_at:330:549; Interrogation_Position=2227; Antisense; GGAGGAACTACGTCGCTACTCGGAT
>probe:Drosophila_2:1626113_at:131:545; Interrogation_Position=2248; Antisense; GGATCCCAAGCTGAAGGCCGGCGAA
>probe:Drosophila_2:1626113_at:346:457; Interrogation_Position=2276; Antisense; GATACCGTGCTGGATATCGACCTGC
>probe:Drosophila_2:1626113_at:495:121; Interrogation_Position=2352; Antisense; AGCGGAATTCCCATCAGCTTGTGAT
>probe:Drosophila_2:1626113_at:205:281; Interrogation_Position=2380; Antisense; CTCATCCTTTGACCGCGGAGTGAAT
>probe:Drosophila_2:1626113_at:309:633; Interrogation_Position=2465; Antisense; TCGCGGCTCAGTTTCAAGTCGTTGC
>probe:Drosophila_2:1626113_at:638:469; Interrogation_Position=2485; Antisense; GTTGCCAAATCTCAGCAGCAGCTGT
>probe:Drosophila_2:1626113_at:626:351; Interrogation_Position=2499; Antisense; GCAGCAGCTGTGAAAGTCTACTCCA
>probe:Drosophila_2:1626113_at:291:169; Interrogation_Position=2530; Antisense; AAATGGAGTATCCTGCCCAACTGAT
>probe:Drosophila_2:1626113_at:222:63; Interrogation_Position=2558; Antisense; ATGTGATCCACTATGATCTGCGCGC
>probe:Drosophila_2:1626113_at:291:659; Interrogation_Position=2598; Antisense; TAAGCTCTGCTCTCTCAAGTATTCA
>probe:Drosophila_2:1626113_at:109:217; Interrogation_Position=2614; Antisense; AAGTATTCACCGCTGGTCGACGGAG
>probe:Drosophila_2:1626113_at:710:423; Interrogation_Position=2636; Antisense; GAGACCCCGAGATCCACATAGAAAG
>probe:Drosophila_2:1626113_at:375:681; Interrogation_Position=2740; Antisense; TATGTTCTCCTCTTTATATAGCAAA

Paste this into a BLAST search page for me
GGAGGAACTACGTCGCTACTCGGATGGATCCCAAGCTGAAGGCCGGCGAAGATACCGTGCTGGATATCGACCTGCAGCGGAATTCCCATCAGCTTGTGATCTCATCCTTTGACCGCGGAGTGAATTCGCGGCTCAGTTTCAAGTCGTTGCGTTGCCAAATCTCAGCAGCAGCTGTGCAGCAGCTGTGAAAGTCTACTCCAAAATGGAGTATCCTGCCCAACTGATATGTGATCCACTATGATCTGCGCGCTAAGCTCTGCTCTCTCAAGTATTCAAAGTATTCACCGCTGGTCGACGGAGGAGACCCCGAGATCCACATAGAAAGTATGTTCTCCTCTTTATATAGCAAA

Full Affymetrix probeset data:

Annotations for 1626113_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime