FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626115_at:

>probe:Drosophila_2:1626115_at:701:259; Interrogation_Position=2035; Antisense; CACGCCCCAAACACGATTATGCAAA
>probe:Drosophila_2:1626115_at:468:363; Interrogation_Position=2076; Antisense; GAATTAATCGATCCAGAGCCGGCAC
>probe:Drosophila_2:1626115_at:36:417; Interrogation_Position=2091; Antisense; GAGCCGGCACCACAGAATGATCTAA
>probe:Drosophila_2:1626115_at:120:231; Interrogation_Position=2106; Antisense; AATGATCTAAAATCCGAGCCGCTTA
>probe:Drosophila_2:1626115_at:639:413; Interrogation_Position=2121; Antisense; GAGCCGCTTAGCGAGAATGAAGTGA
>probe:Drosophila_2:1626115_at:354:17; Interrogation_Position=2245; Antisense; ATTTTTTACTTCATATCGCGTTATA
>probe:Drosophila_2:1626115_at:32:359; Interrogation_Position=2340; Antisense; GCAAAATCAAATGCCGGACCGATGT
>probe:Drosophila_2:1626115_at:123:133; Interrogation_Position=2357; Antisense; ACCGATGTGCATTAGGGTGGCTCAT
>probe:Drosophila_2:1626115_at:127:77; Interrogation_Position=2370; Antisense; AGGGTGGCTCATTTTTCTGATTGTA
>probe:Drosophila_2:1626115_at:535:539; Interrogation_Position=2425; Antisense; GGTATATTTATAGCAAAACGCCCTG
>probe:Drosophila_2:1626115_at:292:675; Interrogation_Position=2501; Antisense; TAGTTGCCGTTTTACAATCCTTTCA
>probe:Drosophila_2:1626115_at:520:43; Interrogation_Position=2534; Antisense; ATCCCGGATATTTAGTTATTAGAGC
>probe:Drosophila_2:1626115_at:317:181; Interrogation_Position=2588; Antisense; AAAAGAACCGATCCATCCTATTGTT
>probe:Drosophila_2:1626115_at:302:449; Interrogation_Position=2597; Antisense; GATCCATCCTATTGTTCATGCGGTA

Paste this into a BLAST search page for me
CACGCCCCAAACACGATTATGCAAAGAATTAATCGATCCAGAGCCGGCACGAGCCGGCACCACAGAATGATCTAAAATGATCTAAAATCCGAGCCGCTTAGAGCCGCTTAGCGAGAATGAAGTGAATTTTTTACTTCATATCGCGTTATAGCAAAATCAAATGCCGGACCGATGTACCGATGTGCATTAGGGTGGCTCATAGGGTGGCTCATTTTTCTGATTGTAGGTATATTTATAGCAAAACGCCCTGTAGTTGCCGTTTTACAATCCTTTCAATCCCGGATATTTAGTTATTAGAGCAAAAGAACCGATCCATCCTATTGTTGATCCATCCTATTGTTCATGCGGTA

Full Affymetrix probeset data:

Annotations for 1626115_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720