Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626117_at:

>probe:Drosophila_2:1626117_at:466:529; Interrogation_Position=2926; Antisense; GGGATCTAAGCCATGTCCAGCTTGC
>probe:Drosophila_2:1626117_at:513:139; Interrogation_Position=2971; Antisense; ACGTCATCCCAGTGCAGAACTACAA
>probe:Drosophila_2:1626117_at:145:161; Interrogation_Position=2992; Antisense; ACAAGTCGATATCGGCTCCTGTTAC
>probe:Drosophila_2:1626117_at:303:137; Interrogation_Position=3021; Antisense; ACGACTGCGACTACCATGTGCAAGT
>probe:Drosophila_2:1626117_at:159:363; Interrogation_Position=3053; Antisense; GAATTGTTCCAAGCTGGGCTGCACC
>probe:Drosophila_2:1626117_at:210:627; Interrogation_Position=3096; Antisense; TGCCGCTTCGGCAAGAACTGCGTAA
>probe:Drosophila_2:1626117_at:544:205; Interrogation_Position=3123; Antisense; AAGCTGGAGTGCATCTTCTACCATC
>probe:Drosophila_2:1626117_at:575:251; Interrogation_Position=3167; Antisense; CAAGTGGGTGGCATCTTTGGGCTAA
>probe:Drosophila_2:1626117_at:719:519; Interrogation_Position=3193; Antisense; GTGGACTGCACTTTCGTTCAAATGA
>probe:Drosophila_2:1626117_at:629:575; Interrogation_Position=3255; Antisense; GGCGAGCTTGGAGTTTTTTCTATCT
>probe:Drosophila_2:1626117_at:633:151; Interrogation_Position=3284; Antisense; ACACCGAGTTGTATACCTTACCTAT
>probe:Drosophila_2:1626117_at:155:725; Interrogation_Position=3326; Antisense; TTGCATTCATCCTACTGCTTATAAT
>probe:Drosophila_2:1626117_at:284:109; Interrogation_Position=3374; Antisense; AGAAGCTCGCTCACATACATGATAA
>probe:Drosophila_2:1626117_at:434:535; Interrogation_Position=3417; Antisense; GGTCCTGCGAATTTGGTTGCATTCA

Paste this into a BLAST search page for me
GGGATCTAAGCCATGTCCAGCTTGCACGTCATCCCAGTGCAGAACTACAAACAAGTCGATATCGGCTCCTGTTACACGACTGCGACTACCATGTGCAAGTGAATTGTTCCAAGCTGGGCTGCACCTGCCGCTTCGGCAAGAACTGCGTAAAAGCTGGAGTGCATCTTCTACCATCCAAGTGGGTGGCATCTTTGGGCTAAGTGGACTGCACTTTCGTTCAAATGAGGCGAGCTTGGAGTTTTTTCTATCTACACCGAGTTGTATACCTTACCTATTTGCATTCATCCTACTGCTTATAATAGAAGCTCGCTCACATACATGATAAGGTCCTGCGAATTTGGTTGCATTCA

Full Affymetrix probeset data:

Annotations for 1626117_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime